Quick Order

Human MFG-E8 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MFG-E8cDNA Clone Product Information
cDNA Size:1164
cDNA Description:ORF Clone of Homo sapiens milk fat globule-EGF factor 8 protein DNA.
Gene Synonym:BA46, SED1, hP47, EDIL1, SPAG10, OAcGD3S, HsT19888, MFGE8
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1155 G/A not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

MFG-E8, also known as lactadherin and MFGE8, contains 1 EGF-like domain and 2 F5/8 type C domains. It also contains a phosphatidylserine (PS) binding domain, as well as an Arginine-Glycine-Aspartic acid motif, which enables the binding to integrins. It binds PS, which is exposed on the surface of apoptotic cells. MFG-E8 is expressed in mammary epithelial cell surfaces and aortic media. Overexpression of MFG-E8 can be found in several carcinomas. MFG-E8 has an opsonization of the apoptotic cells and binding to integrins on the surface of phagocytic cells. It also mediates the engulfment of the dead cell. MFG-E8 plays an important role in the maintenance of intestinal epithelial homeostasis and the promotion of mucosal healing. It promotes VEGF-dependent neovascularization and contributes to phagocytic removal of apoptotic cells in many tissues. It also binds to phosphatidylserine-enriched cell surfaces in a receptor-independent manner.

  • Oshima K, et al. (2002) Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles. Eur J Biochem. 269(4):1209-18.
  • Hanayama R, et al. (2002) Identification of a factor that links apoptotic cells to phagocytes. Nature. 417 (6885):182-7.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Size / Price
    List Price: $395.00  (Save $100.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human MFG-E8 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged