After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PVRL3 / PRR3 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human PVRL3/PRR3 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Poliovirus receptor-related 3 (PVRL3), also known as Nectin-3 and CD113, is a member of the nectin family. PVRL3/Nectin-3 is an 83 kDa, type I transmembrane glycoprotein. Its precursor is 549 amino acids (aa) in length and contains an extended signal sequence of 57 aa, an extracellular domain (ECD) of 347 aa, a transmembrane segment of 21 aa, and a cytoplasmic region of 124 aa. Nectin-3 has three splicing variants, nectin-3alpha (biggest), -3beta (middle), and -3gamma (smallest). It is predominantly expressed in testis and placenta as well as in various cell lines, including epithelial cell lines. PVRL3/Nectin-3 plays a role in cell-cell adhesion through heterophilic trans-interactions with nectin-like proteins or nectins, such as trans-interaction with PVRL2/Nectin-2 at Sertoli-spermatid junctions. PVRL3/Nectin-3 is thus involved in the formation of cell-cell junctions, including adherens junctions and synapses. It has been shown to induce endocytosis-mediated down-regulation of PVR from the cell surface, resulting in reduction of cell movement and proliferation.

  • Satoh-Horikawa, et al. (2000). Nectin-3, a new member of immunoglobulin-like cell adhesion molecules that shows homophilic and heterophilic cell-cell adhesion activities. J Biol Chem (UNITED STATES) . 275 (14): 10291-9.
  • Reymond N, et al. (2000). Human nectin3/PRR3: a novel member of the PVR/PRR/nectin family that interacts with afadin. Gene (NETHERLANDS). 255 (2): 347-55.