Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human DEFB103A cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human DEFB103A Gene Plasmid Map
Human DEFB103A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Beta-defensin 3 is a member of the defensin family. Defensin family is comprised by microbicidal and cytotoxic peptides made by neutrophils. Members of the beta-defensin 3 family are highly similar in protein sequence. Beta-defensin 3 shows antimicrobial activity against Gram-positive bacteria S.aureus and S.pyogenes, Gram-negative bacteria P.aeruginosa and E.coli and the yeast C.albicans. Beta-defensin 3 is abundantly expressed in skin and tonsils, and to a lesser extent in trachea, uterus, kidney, thymus, adenoid, pharynx and tongue. It is also expressed in salivary gland, bone marrow, colon, stomach, polyp and larynx. However, in small intestine, it cannot be detected. Defensin has broad spectrum antimicrobial activity and may play an important role in innate epithelial defense. Beta-defensin 3 kills multiresistant S.aureus and vancomycin-resistent E.faecium. It has no significant hemolytic activity.

References
  • Garca JR, et al. (2002) Identification of a novel, multifunctional beta-defensin (human beta-defensin 3) with specific antimicrobial activity. Its interaction with plasma membranes of Xenopus oocytes and the induction of macrophage chemoattraction. Cell Tissue Res. 306(2):257-64.
  • Dunsche A, et al. (2002) The novel human beta-defensin-3 is widely expressed in oral tissues. Eur J Oral Sci. 110(2):121-4.
  • Abiko Y, et al. (2004) Upregulated expression of human beta defensin-1 and -3 mRNA during differentiation of keratinocyte immortalized cell lines, HaCaT and PHK16-0b. J Dermatol Sci. 31(3): 225-8.
  • Images
    • Human DEFB103A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"