Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human YWHAH cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
  • Wakui H, et al. (1997) Interaction of the ligand-activated glucocorticoid receptor with the 14-3-3 eta protein. J Biol Chem. 272(13): 8153-6.
  • Toyooka K, et al. (2002) Isolation and structure of the mouse 14-3-3 eta chain gene and the distribution of 14-3-3 eta mRNA in the mouse brain. Brain Res Mol Brain Res. 100(1-2): 13-20.
  • Kim YS, et al. (2005) Role of 14-3-3 eta as a positive regulator of the glucocorticoid receptor transcriptional activation. Endocrinology. 146(7): 3133-40.
  • Grover D, et al. (2009) Family-based association of YWHAH in psychotic bipolar disorder. Am J Med Genet B Neuropsychiatr Genet. 150B(7): 977-83.
  • Images
    • Human YWHAH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items