Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human YWHAQ cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human YWHAQ Gene Plasmid Map
Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
  • Cheng Y, et al. (2010) Effect of 14-3-3 tau protein on differentiation in BeWo choriocarcinoma cells. Placenta. 31(1): 60-6.
  • Umahara T, et al. (2010) 14-3-3 proteins and spinocerebellar ataxia type 1: from molecular interaction to human neuropathology. Cerebellum. 9(2): 183-9.
  • Wang B, et al. (2004) A role for 14-3-3 tau in E2F1 stabilization and DNA damage-induced apoptosis. J Biol Chem. 279(52): 54140-52.
  • Images
    • Human YWHAQ Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items