Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human YWHAS/SFN cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

14-3-3 protein sigma (YWHAS), also known as stratifin (SFN) and epithelial cell marker protein 1, is a member of the14-3-3 proteins which are a family of conserved regulatory molecules expressed in all eukaryotic cells. The name 14-3-3 refers to the particular elution and migration pattern of these proteins on DEAE-cellulose chromatography and starch-gel electrophoresis. The 14-3-3 proteins eluted in the 14th fraction of bovine brain homogenate and were found on positions 3.3 of subsequent electrophoresis. There are seven genes that encode 14-3-3s in most mammals. 14-3-3 proteins have been identified as adapter proteins implicated in the regulation of a large spectrum of both general and specialized signaling pathway. More than 100 signaling proteins have been reported as 14-3-3 ligands including kinases, phosphatases, and transmembrane receptors, and the binding generally results in the modulation of the activity of the binding partner. YWHAE exists as a homodimer and present mainly in tissues enriched in stratified squamous keratinising epithelium. YWHAS has been repoted to interact with KRT17 and GAB2, and may regulate protein synthesis and epithelial cell growth by stimulating Akt/mTOR pathway upon binding to KRT17. Additionally, YWHAS (SFN) may also act as a p53-regulated inhibitor of G2/M progression.

  • Human SFN Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items