Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD150/SLAM cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

CD150/signaling lymphocytic activation molecule (SLAM) is a cell surface sialylated phosphoglycoprotein and belongs to the CD2 subset of the Ig superfamily of type I transmembrane glycoproteins. The CD150 receptor is expressed on thymocytes, activated and memory T cells, B cells, platelets, natural killer T cells, and mature dendritic cells, and is also detected on tumor cells of Hodgkin's lymphoma (HL) and diffuse large B-cell lymphoma with an activated B cell phenotype. Additionally, it is the immune cell receptor for measles virus (MV). As a self-ligand, CD150 performs diverse immunologic functions including T/B-cell costimulation, induction of IFN-&gamma in Th1 T-cell clones, redirection of Th2 clones to a Th1 or Th0 phenotype, and inhibition of apoptosis in B cells. Furthermore, CD150 was shown to be the second receptor for measles virus in addition to CD46, and the distribution of SLAM on various cell lines is consistent with their susceptibility to clinical isolates of measles virus.

  • Tatsuo H, et al. (2002) The morbillivirus receptor SLAM (CD150). Microbiol Immunol. 46(3): 135-42.
  • Sidorenko SP, et al. (2003)The dual-function CD150 receptor subfamily: the viral attraction. Nat Immunol. 4(1): 19-24.
  • Yurchenko MY, et al. (2010) CD150 regulates JNK1/2 activation in normal and Hodgkin's lymphoma B cells. Immunol Cell Biol. 88(5): 565-74.
  • Leonard VH, et al. (2010) Measles virus selectively blind to signaling lymphocytic activation molecule (SLAM ; CD150) is attenuated and induces strong adaptive immune responses in rhesus monkeys. J Virol. 84(7): 3413-20.
  • Images
    • Human CD150 / SLAM Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items