After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CD150 / SLAM ORF mammalian expression plasmid, Flag tag

DatasheetReviewsRelated ProductsProtocols
Human CD150/SLAM cDNA Clone Product Information
NCBI RefSeq:NM_003037.2
RefSeq ORF Size:1008bp
cDNA Description:Full length Clone DNA of Homo sapiens signaling lymphocytic activation molecule family member 1 with Flag tag.
Gene Synonym:SLAM, CD150, CDw150, SLAMF1
Restriction Site:HindIII + XbaI (5.4kb + 1.06kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CD150/SLAM Gene Plasmid Map
Human CD150 / SLAM Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Human CD150/SLAM Gene Expression validated Image
[Click to enlarge image]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Human CD150 / SLAM natural ORF mammalian expression plasmid, Flag tag
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

CD150/signaling lymphocytic activation molecule (SLAM) is a cell surface sialylated phosphoglycoprotein and belongs to the CD2 subset of the Ig superfamily of type I transmembrane glycoproteins. The CD150 receptor is expressed on thymocytes, activated and memory T cells, B cells, platelets, natural killer T cells, and mature dendritic cells, and is also detected on tumor cells of Hodgkin's lymphoma (HL) and diffuse large B-cell lymphoma with an activated B cell phenotype. Additionally, it is the immune cell receptor for measles virus (MV). As a self-ligand, CD150 performs diverse immunologic functions including T/B-cell costimulation, induction of IFN-&gamma in Th1 T-cell clones, redirection of Th2 clones to a Th1 or Th0 phenotype, and inhibition of apoptosis in B cells. Furthermore, CD150 was shown to be the second receptor for measles virus in addition to CD46, and the distribution of SLAM on various cell lines is consistent with their susceptibility to clinical isolates of measles virus.

  • Tatsuo H, et al. (2002) The morbillivirus receptor SLAM (CD150). Microbiol Immunol. 46(3): 135-42.
  • Sidorenko SP, et al. (2003)The dual-function CD150 receptor subfamily: the viral attraction. Nat Immunol. 4(1): 19-24.
  • Yurchenko MY, et al. (2010) CD150 regulates JNK1/2 activation in normal and Hodgkin's lymphoma B cells. Immunol Cell Biol. 88(5): 565-74.
  • Leonard VH, et al. (2010) Measles virus selectively blind to signaling lymphocytic activation molecule (SLAM ; CD150) is attenuated and induces strong adaptive immune responses in rhesus monkeys. J Virol. 84(7): 3413-20.
  • Size / Price
    Catalog: HG10837-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.