Quick Order

Text Size:AAA

Human CXCL16 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CXCL16cDNA Clone Product Information
cDNA Size:822
cDNA Description:ORF Clone of Homo sapiens chemokine (C-X-C motif) ligand 16 DNA.
Gene Synonym:SRPSOX, CXCLG16, SR-PSOX, CXCL16, S6K-alpha, S6K-alpha2, RPS6KA2
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for two point mutations: 306 G/A and 678A/G not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Chemokine & Receptor Related Products
Product nameProduct name

C-X-C motif chemokine 16, also known as Small-inducible cytokine B16, SR-PSOX, and CXCL16, is a single-pass type I membrane protein which belongs to the intercrine alpha (chemokine CxC) family. CXCL16 exists in transmembrane and soluble forms. The transmembrane form acts as a scavenger receptor for oxidised LDL whereas the soluble form acts a chemoattractant for mainly CD8+ T cells. CXCL16 is a protein which shares pattern recognition receptor functions, relevant for adhesion and phagocytosis of bacterial products, with the properties of an adhesion molecule and inflammatory chemokine. CXCL16/SR-PSOX is an interferon-gamma-regulated chemokine and scavenger receptor for oxidized low-density lipoprotein that is expressed in atherosclerotic lesions. Proteolytic cleavage of membrane-bound CXCL16 releases soluble CXCL16, which may promote migration of effector T cells and augment a proatherogenic inflammatory response. CXCL16/SR-PSOX can be a potential player in atherogenesis. Enhanced expression of CXCL16 has been demonstrated in atherosclerotic plaques and several properties have been attributed to CXCL16 that could influence the atherosclerotic process. Following in vitro studies suggested that as an adhesion molecule CXCL16/SR-PSOX might mediate T-cell adhesion to the endothelium, as a chemokine-drive T-cell migration, stimulate cell proliferation and elicit inflammatory phenotype in smooth muscle cells (SMC) and, finally, as a scavenger receptor-mediate uptake of atherogenic lipoproteins by macrophages and SMC. CXCR6 and its ligand CXCL16 in regulating metastasis and invasion of cancer. CXCR6 and CXCL16 are up-regulated in multiple cancer tissue types and cancer cell lines relative to normal tissues and cell lines. In addition, both CXCR6 and CXCL16 levels increase as tumor malignancy increases. Thus, CXCL16 and CXCR6 may mark cancers arising in an inflammatory milieu and mediate pro-tumorigenic effects of inflammation through direct effects on cancer cell growth and by inducing the migration and proliferation of tumor-associated leukocytes.

  • Sheikine Y, et al. (2008) CXCL16/SR-PSOX--a friend or a foe in atherosclerosis? Atherosclerosis. 197(2): 487-95.
  • Lehrke M, et al. (2008) CXCL16 is a surrogate marker of inflammatory bowel disease. Scand J Gastroenterol. 43(3): 283-8.
  • Jansson AM, et al. (2009) Soluble CXCL16 predicts long-term mortality in acute coronary syndromes. Circulation. 119(25): 3181-8.
  • Darash-Yahana M, et al. (2009) The chemokine CXCL16 and its receptor, CXCR6, as markers and promoters of inflammation-associated cancers. PLoS One. 4(8): e6695.
  • Deng L, et al. (2010) CXCR6/CXCL16 functions as a regulator in metastasis and progression of cancer. Biochim Biophys Acta. 1806(1): 42-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human CXCL16 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items