Quick Order

Text Size:AAA

Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CEACAM6cDNA Clone Product Information
cDNA Size:1035
cDNA Description:ORF Clone of Homo sapiens carcinoembryonic antigen-related cell adhesion molecule 6 (non-specific cross reacting antigen) DNA.
Gene Synonym:NCA, CEAL, CD66c, CEACAM6
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Related Products
Product nameProduct name

Carcinoembryonic antigen-related cell adhesion molecule 6 (CEACAM6), also known as nonspecific crossreacting antigen (NCA) and CD66c, is one of seven human CEACAM family members within the immunoglobulin superfamily. It s a glycosylphosphatidylinositol-linked immunoglobulin superfamily member that is overexpressed in a variety of human cancers, including colon, breast and lung and is associated with tumourigenesis, tumour cell adhesion, invasion and metastasis. CEACAM6 is a unique mediator of migration and invasion of drug resistant oestrogen-deprived breast cancer cells, and this protein could be an important biomarker of metastasis. CEACAM6 is expressed by granulocytes and their progenitors. It is also expressed by epithelia of various organs and is upregulated in pancreatic and colon adenocarcinomas, as well as hyperplastic polyps. Resistance to adhesion-related apoptosis in tumor cells is conferred in the condition of CEACAM6 overexpression.

  • Duxbury MS, et al. (2004) Overexpression of CEACAM6 promotes insulin-like growth factor I-induced pancreatic adenocarcinoma cellular invasiveness. Oncogene. 23(34): 5834-42.
  • Lewis-Wambi JS, et al. (2008) Overexpression of CEACAM6 promotes migration and invasion of oestrogen-deprived breast cancer cells. Eur J Cancer. 44(12): 1770-9.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human CD66c / CEACAM6 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items