Quick Order

Human ApoE ORF mammalian expression plasmid, His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ApoE cDNA Clone Product Information
RefSeq ORF Size:954bp
cDNA Description:Full length Clone DNA of Homo sapiens apolipoprotein E with His tag.
Gene Synonym:AD2, LPG, MGC1571, apoprotein, APOE
Restriction Site:KpnI + XhoI (5.5kb + 0.98kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ApoE Gene Plasmid Map
Human ApoE Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

Apolipoprotein E (ApoE) is a 34.2 kDa glycosylated protein with 299 amino acid residues. There are three isoforms in human (apoE2, apoE3, and apoE4) due to different amino acid residues at positions 112 and 158. ApoE is synthesized predominantly in the liver, but also by cells in the spleen, brain, lung, kidney, ovary, adrenal, and muscle tissues. Hepatic parenchyma cells are the main apoE producing cells in mammalian body, probably accounting for two thirds to three fourths of the plasma apoE . In the nervous system, apoE mRNA is present in neurons, astrocytes, ependymal cells, nonmyelinating Schwann cells, but not in microglia, oligodendroglia, choroidal cells, or myelinating Schwann cells. ApoE produced by mammalian cells exists in different forms, monomers, dimers, modified, unmodified, lipid-rich, and lipid-poor, and so forth. ApoE plays a double-role in immune responses. Both apoE containing lipoproteins and multimers of synthetic apoE peptides inhibited proliferation of cultured lymphocytes by inhibiting DNA synthesis and reducing phospholipid turnover in T cells. ApoE can also affect innate and acquired immune responses in vitro by its ability to suppress stimulation of cultured neutrophils. ApoE can bind lipopolysaccharide (LPS), attenuate the inflammatory response, and thus reduce LPS induced lethality. Injection of LPS stimulated higher expression of inflammatory cytokines like interleukin (IL)-1β, IL-12, and interferon-γ (IFN-γ), as well as IL-6.

  • Mahley RW. (1988) Apolipoprotein E: cholesterol transport protein with expanding role in cell biology. Science. 240(4852): 622-30.
  • Aleshkov S, et al. (1989) Interaction of nascent apoe2, apoe3, and apoe4 isoforms expressed in mammalian cells with amyloid peptide. Relevance to Alzheimer's disease. Biochemistry. 36(34): 10571-80.
  • Hussain MM, et al. (1997) Synthesis, modification, and flotation properties of rat hepatocyte apolipoproteins. Biochimica et Biophysica Acta. 101(1): 90-101.
  • Size / Price
    Catalog: HG10817-M-H
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions