After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD21cDNA Clone Product Information
cDNA Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD21, also known as Complement component (3d / Epstein Barr virus) receptor 2 and CR2, is a member of the CD system and is a protein involved in complement system. CD21 is present on all mature B-cells and some T-cells and follicular dendritic cells. CD21 on mature B-cells form a complex called the B cell receptor complex with two other membrane proteins, CD19 and CD81. CD21 has a function in the complement system through serving as the cellular receper specific for ligands such as C3 and C4 which can be attached to foreign macromolecules in order to remove or uptake them. This results in B-cells having enhanced response to the antigen.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Joseph M, et al. (1989) Structure and Function of the Complement Receptors, CR1 (CD35) and CR2 (CD21). Advanced in immunology. 46: 183-219.
  • Aubry JP, et al. (1992) CD21 is a ligand for CD23 and regulates IgE production. Nature 358: 505 - 7.
  • Size / Price
    • Human CR2 / CD21 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items