Quick Order

Text Size:AAA

Human CD10 / MME Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD10/MMEcDNA Clone Product Information
cDNA Size:2253
cDNA Description:ORF Clone of Homo sapiens membrane metallo-endopeptidase DNA.
Gene Synonym:NEP, CD10, CALLA, MGC126681, MGC126707, DKFZp686O16152, MME
Restriction Site:HindIII + ApaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 10 (CD10), also known as Neprilysin and neutral endopeptidase, is a member of the CD system. CD10 is a zinc-dependent metalloprotease enzyme that had function to degrade a number of small secreted peptides such as the amyloid beta peptide. It exist as a membrane-bound protein and have high concentration in kidney and lung tissues. Mutations in the CD10 gene can induce the familial forms of Alzheimer's disease, providing strong evidence for the protein's association with the Alzheimer's disease process. CD10 is also associated with other biochemical processes.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Dogan, et al. (2000) CD10 and BCL-6 Expression in Paraffin Sections of Normal Lymphoid Tissue and B-Cell Lymphomas. American Journal of Surgical Pathology. 24(6): 846-52.
  • Size / Price
    List Price: $545.00  (Save $230.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human CD10 / MME Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items