Quick Order

Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAP3K8cDNA Clone Product Information
cDNA Size:1404
cDNA Description:ORF Clone of Homo sapiens mitogen-activated protein kinase kinase kinase 8 DNA.
Gene Synonym:COT, EST, ESTF, TPL2, Tpl-2, c-COT, FLJ10486
Restriction Site:NheI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10800-ACG$325
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10800-ACR$325
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10800-ANG$325
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10800-ANR$325
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10800-CF$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10800-CH$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10800-CM$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10800-CY$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone)HG10800-M$95
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10800-M-F$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, His-taggedHG10800-M-H$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10800-NF$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10800-NH$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10800-NM$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10800-NY$295
Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10800-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Mitogen-activated protein kinase kinase kinase 8, also known as Cancer Osaka thyroid oncogene, Proto-oncogene c-Cot, Serine/threonine-protein kinase cot, Tumor progression locus 2 and MAP3K8, is a cytoplasm protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase kinase subfamily. MAP3K8 is expressed in several normal tissues and human tumor-derived cell lines. Isoform 1 of MAP3K8 is activated specifically during the S and G2/M phases of the cell cycle. MAP3K8 is required for TLR4 activation of the MEK/ERK pathway. It is able to activate NF-kappa-B 1 by stimulating proteasome-mediated proteolysis of NF-kappa-B 1/p105. MAP3K8 plays a role in the cell cycle. The longer form has some transforming activity, although it is much weaker than the activated cot oncoprotein. MAP3K8 oncogene linked to human endometrial carcinoma suggesting that it may be another molecule involved in human endometrial cancer. MAP3K8 may also be an important mediator of intracellular mechanotransduction in human bone marrow-derived mesenchymal stem cells (MSCs).

  • Clark,A.M. et al., 2004, Genes Chromosomes Cancer. 41 (2):99-108.
  • Chan,H. et al., 2005, Biochem Biophys Res Commun. 328 (1):198-205.
  • Aparecida Alves,C. et al., 2006, Eur J Gynaecol Oncol. 27 (6):589-93.
  • Mielke,L.A. et al., 2009, J Immunol. 183 (12):7984-93.
  • Glossop,J.R. et al., 2009,Gene Expr Patterns  9 (5):381-8. 
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human MAP3K8 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items