Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD48 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human CD48 Gene Plasmid Map
Human CD48 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Cluster of Differentiation 48 (CD48), also known as SLAMF2, BCM-1 and BLAST-1, is a GPI-linked protein belonging to the CD2 subfamily of immunoglobulin superfamily molecules. CD2 and 2B4 (CD244) are known ligands for CD48. CD48 protein is expressed on most lineage-committed hematopoietic cells but not on hematopoietic stem cells or multipotent hematopoietic progenitors. CD48 protein performs biological functions in a variety processes including adhesion, pathogen recognition, cellular activation, and cytokine regulation, and emerges as a critical effector molecule in immune responses.

References
  • Messmer B, et al. (2006) CD48 stimulation by 2B4 (CD244)-expressing targets activates human NK cells. J Immunol. 176(8): 4646-50
  • Milstein O, et al. (2008) Nanoscale increases in CD2-CD48-mediated intermembrane spacing decrease adhesion and reorganize the immunological synapse. J Biol Chem. 283(49): 34414-22.
  • Images
    • Human CD48 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"