After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human CD48 ORF mammalian expression plasmid, Flag tag

DatasheetReviewsRelated ProductsProtocols
Human CD48 cDNA Clone Product Information
NCBI RefSeq:NM_001778.2
RefSeq ORF Size:732bp
cDNA Description:Full length Clone DNA of Homo sapiens CD48 molecule with Flag tag.
Gene Synonym:BCM1, BLAST, hCD48, mCD48, BLAST1, SLAMF2, MEM-102
Restriction Site:KpnI + XhoI (5.4kb + 0.78kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 448T/C not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CD48 Gene Plasmid Map
Human CD48 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
Human CD48 Gene Expression validated Image
[Click to enlarge image]
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Human CD48 natural ORF mammalian expression plasmid, Flag tag
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Cluster of Differentiation 48 (CD48), also known as SLAMF2, BCM-1 and BLAST-1, is a GPI-linked protein belonging to the CD2 subfamily of immunoglobulin superfamily molecules. CD2 and 2B4 (CD244) are known ligands for CD48. CD48 protein is expressed on most lineage-committed hematopoietic cells but not on hematopoietic stem cells or multipotent hematopoietic progenitors. CD48 protein performs biological functions in a variety processes including adhesion, pathogen recognition, cellular activation, and cytokine regulation, and emerges as a critical effector molecule in immune responses.

  • Messmer B, et al. (2006) CD48 stimulation by 2B4 (CD244)-expressing targets activates human NK cells. J Immunol. 176(8): 4646-50
  • Milstein O, et al. (2008) Nanoscale increases in CD2-CD48-mediated intermembrane spacing decrease adhesion and reorganize the immunological synapse. J Biol Chem. 283(49): 34414-22.
  • Size / Price
    Catalog: HG10797-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.