Quick Order

Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MAPK8cDNA Clone Product Information
cDNA Size:1284
cDNA Description:ORF Clone of Homo sapiens mitogen-activated protein kinase 8, transcript variant JNK1-b2 DNA.
Gene Synonym:JNK, JNK1, PRKM8, SAPK1, JNK1A2, JNK21B1/2
Restriction Site:KpnI + XhoI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged on other vectors
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10795-ACG$325
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10795-ACR$325
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10795-ANG$325
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10795-ANR$325
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10795-CF$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10795-CH$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10795-CM$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10795-CY$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone)HG10795-M$95
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10795-M-N$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10795-NF$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10795-NH$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10795-NM$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10795-NY$295
Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10795-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

Mitogen-activated protein kinase 8 (MAPK8), also known as JNK1, is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. The protein kinases JNK1 has been found to serve as critical molecular links between obesity, metabolic inflammation, and disorders of glucose homeostasis. It is critically involved in the promotion of diet-induced obesity, metabolic inflammation and beta-cell dysfunction. The selective deficiency of JNK1 in the murine nervous system is sufficient to suppress diet-induced obesity. Genetic analysis indicates that the effects of JNK1 can be separated from effects of JNK1 on obesity. JNK1 is a potential pharmacological target for the development of drugs that might be useful for the treatment of metabolic syndrome, and type 2 diabetes. Furthermore, JNK1 plays a major role in the hypoxic cellular damage. JNK1 protein might be an attractive target for antihypoxic therapy in increasing resistance to many pathological conditions and diseases, leading to the oxygen deficit.

  • Betigeri S, et al. (2006) JNK1 as a molecular target to limit cellular mortality under hypoxia. Mol Pharm. 3(4): 424-30.
  • Solinas G, et al. (2010) JNK1 and IKKbeta: molecular links between obesity and metabolic dysfunction. FASEB J. 24(8): 2596-611.
  • Sabio G, et al. (2010) Role of the hypothalamic-pituitary-thyroid axis in metabolic regulation by JNK1. Genes Dev. 24(3): 256-64.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    • Human MAPK8 transcript variant JNK1-b2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items