After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CD5L cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

CD5L, also known as CD5 antigen-like, is a soluble protein belonging to group B of the scavenger receptor cysteine-rich (SRCR) superfamily and contains three SRCR domains. It is a secreted glycoprotein and expressed by macrophages presentin lymphoid tissues (spleen, lymph node, thymus, and bone marrow). It binds to myelomonocytic and lymphoid cells and may play an important role in the regulation of the innate and adaptive immune systems. CD5L functions as a pattern recognition molecule by binding both lipoteichoic acid (LTA) on Gram positive and lipopolysaccharide (LPS) on Gram negative bacteria. and the SRCR domain 1 of CD5L retains both the LPS and LTA binding activities. In addtion, it is revealed that CD5L seems to play a role as an inhibitor of apoptosis.

  • Resnick, D. et al., 1994, Trends Biochem. Sci. 19: 5-8.
  • Gebe, J. A. et al., 1997, J. Biol. Chem. 272 (10): 6151–6158.
  • Sarrias, M.R. et al., 2004, Crit. Rev. Immunol. 24: 1-37.
  • Mukhopadhyay, S. and Gordon, S., 2004, Immunobiology 209: 39-49.
  • Sarrias, M. R. et al.,2005, J. Biol. Chem. 280 (42): 35391–35398.
  • Images
    • Human CD5L Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items