Quick Order

Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
MASTL/THC2cDNA Clone Product Information
Gene_bank_ref_id:NM_032844.2
cDNA Size:2637
cDNA Description:ORF Clone of Homo sapiens microtubule associated serine/threonine kinase-like DNA.
Gene Synonym:THC2, FLJ14813, RP11-85G18.2, MASTL
Species:Human
Vector:pCMV/hygro
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1782 C/T not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10761-ACG$425
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10761-ACR$425
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10761-ANG$425
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10761-ANR$425
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10761-CF$395
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10761-CH$395
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10761-CM$395
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10761-CY$395
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone)HG10761-M$145
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10761-M-F$395
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10761-NF$395
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10761-NH$395
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10761-NM$395
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10761-NY$395
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10761-UT$395
 Learn more about expression Vectors
Related Products
Product nameProduct name
Size / Price
Catalog:HG10761-M-N
List Price: $395.00  (Save $0.00)
Price:$395.00      [How to order]
Availability5 business days
Images
  • Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"