Quick Order

Human CDC2 Kinase / CDK1 transcript variant 1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CDK1/CDC2 cDNA Clone Product Information
RefSeq ORF Size:894bp
cDNA Description:Full length Clone DNA of Homo sapiens cell division cycle 2, G1 to S and G2 to M transcript variant 1.
Gene Synonym:CDK1, CDC28A, MGC111195, DKFZp686L20222, CDC2
Restriction Site:HindIII + XhoI (5.5kb + 0.89kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CDK1/CDC2 Gene Plasmid Map
Human CDC2 Kinase / CDK1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human CDC2 Kinase / CDK1 transcript variant 1 natural ORF mammalian expression plasmid on other vectors
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, C-GFPSpark tagHG10739-ACG$325
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10739-ACR$325
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, N-GFPSpark tagHG10739-ANG$325
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10739-ANR$325
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, C-Flag tagHG10739-CF$295
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, C-His tagHG10739-CH$295
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, C-Myc tagHG10739-CM$295
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, C-HA tagHG10739-CY$295
Human CDC2 Kinase / CDK1 transcript variant 1 Gene cDNA clone plasmidHG10739-M$195
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, Flag tagHG10739-M-F$395
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, N-Flag tagHG10739-NF$295
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, N-His tagHG10739-NH$295
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, N-Myc tagHG10739-NM$295
Human CDC2 Kinase / CDK1 transcript variant 1 ORF mammalian expression plasmid, N-HA tagHG10739-NY$295
Human CDC2 Kinase / CDK1 transcript variant 1 natural ORF mammalian expression plasmidHG10739-UT$295
 Learn more about expression Vectors
Product nameProduct name

CDC2, also known as CDK1, contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family, CDC2/CDKX subfamily. CDC2 is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with CDC2 and function as regulatory subunits. The kinase activity of CDK1 is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of CDC2 also play important regulatory roles in cell cycle control. It is required in higher cells for entry into S-phase and mitosis. CDC2 also is a cyclin-dependent kinase which displays CTD kinase activity and is required for RNA splicing. It has CTD kinase activity by hyperphosphorylating the C-terminal heptapeptide repeat domain (CTD) of the largest RNA polymerase II subunit RPB1, thereby acting as a key regulator of transcription elongation. CDK1 is required for RNA splicing, possibly by phosphorylating SRSF1/SF2. It is involved in regulation of MAP kinase activity, possibly leading to affect the response to estrogn inhibitors.

  • Lee MG, et al. (1987) Complementation used to clone a human homologue of the fission yeast cell cycle control gene cdc2. Nature. 327(6117):31-5.
  • Enserink JM, et al. (2010) An overview of Cdk1-controlled targets and processes. Cell Division. 5(11): 1-41.
  • Ninomiya-Tsuji J, et al. (1991) Cloning of a human cDNA encoding a CDC2-related kinase by complementation of a budding yeast cdc28 mutation. Proc Natl Acad Sci. 88(20):9006-10.
  • Zhan Q, et al. (1999) Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene. 18(18):2892-900.
  • Jin S, et al. (2000) The GADD45 inhibition of Cdc2 kinase correlates with GADD45-mediated growth suppression. J Biol Chem. 275(22):16602-8.

    Size / Price
    Catalog: HG10739-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions