Quick Order

Human BUB1B Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
BUB1BcDNA Clone Product Information
cDNA Size:3153
cDNA Description:ORF Clone of Homo sapiens budding uninhibited by benzimidazoles 1 homolog beta (yeast) DNA.
Gene Synonym:SSK1, BUBR1, Bub1A, MAD3L, hBUBR1, BUB1beta, BUB1B
Restriction Site:KpnI + PmeI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name