After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human APP/PN2 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Amyloid precursor protein (APP) is a type I transmembrane protein expressed in many tissues and concentrated in the synapses of neurons, and is suggested as a regulator of synapse formation and neural plasticity. APP can be processed by two different proteolytic pathways. In one pathway, APP is cleaved by β- and γ-secretase to produce the amyloid-β-protein (Aβ, Abeta, beta-amyloid) which is the principal component of the amyloid plaques, the major pathological hallmark of Alzheimer’s disease (AD), while in the other pathway, α-secretase is involved in the cleavage of APP whose product exerts antiamyloidogenic effect and prevention of the Aβ peptide formation. The aberrant accumulation of aggregated beta-amyloid peptides (Abeta) as plaques is a hallmark of AD neuropathology and reduction of Abeta has become a leading direction of emerging experimental therapies for the disease. Besides this pathological function of Abeta, recently published data reveal that Abeta also has an essential physiological role in lipid homeostasis. Cholesterol increases Abeta production, and conversely A beta production causes a decrease in cholesterol synthesis. Abeta may be part of a mechanism controlling synaptic activity, acting as a positive regulator presynaptically and a negative regulator postsynaptically. The pathological accumulation of oligomeric Abeta assemblies depresses excitatory transmission at the synaptic level, but also triggers aberrant patterns of neuronal circuit activity and epileptiform discharges at the network level. Abeta-induced dysfunction of inhibitory interneurons likely increases synchrony among excitatory principal cells and contributes to the destabilization of neuronal networks. There is evidence that beta-amyloid can impair blood vessel function. Vascular beta-amyloid deposition, also known as cerebral amyloid angiopathy, is associated with vascular dysfunction in animal and human studies. Alzheimer disease is associated with morphological changes in capillary networks, and soluble beta-amyloid produces abnormal vascular responses to physiological and pharmacological stimuli.

References
  • Grimm MO, et al. (2007) Amyloid beta as a regulator of lipid homeostasis. Trends Mol Med. 13(8): 337-44.
  • Smith EE, et al. (2009) Beta-amyloid, blood vessels, and brain function. Stroke. 40(7): 2601-6.
  • Gouras GK, et al. (2010) Intraneuronal beta-amyloid accumulation and synapse pathology in Alzheimer's disease. Acta Neuropathol. 119(5): 523-41.
  • Palop JJ, et al. (2010) Amyloid-beta-induced neuronal dysfunction in Alzheimer's disease: from synapses toward neural networks. Nat Neurosci. 13(7): 812-8.
  • Images
    • Human APP / PN2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"