After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human ANGPT2 / Angiopoietin-2 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ANG2 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.


Angiopoietin-2 (ANG 2, or ANGPT2), is a member of the ANG family, which plays an important role in angiogenesis during the development and growth of human cancers. Both ANGPT-1 and ANGPT-2 appear to bind to the tyrosine kinase receptor, Tie-2, found primarily on the luminal surface of endothelial cells. ANG-2's role in angiogenesis generally is considered as an antagonist for ANG1, inhibiting ANG1-promoted Tie2 signaling, which is critical for blood vessel maturation and stabilization. ANG-2 modulates angiogenesis in a cooperative manner with another important angiogenic factor, vascular endothelial growth factor A. Genetic studies have revealed that ANG-2 also is critical in lymphangiogenesis during development. ANG-2 has multiple physiologic effects that regulate vascular tone, hormone secretion, tissue growth and neural activity. Several reports indicate that ANG-2 can induce neovascularization in experimental systems due to the expression of different growth factors such as angiopoietin 2, vascular endothelial factor, and its receptor, fibroblast growth factor, platelet derived growth factor, transforming growth factor beta and epidermal growth factor. In addition, ANG-2 is strongly expressed in the vasculature of many tumors and it has been suggested that ANG-2 may act synergistically with other cytokines such as vascular endothelial growth factor to promote tumor-associated Angiogenesis and tumor progression.

  • Thomas M, et al. (2009) The role of the Angiopoietins in vascular morphogenesis. Angiogenesis. 12(2): 125-37.
  • Hu B, et al. (2009) Angiopoietin-2: development of inhibitors for cancer therapy. Curr Oncol Rep. 11(2): 111-6.
  • Fiedler U, et al. (2006) Angiopoietins: a link between angiogenesis and inflammation. Trends Immunol. 27: 552-8.
  • Escobar E, et al. (2004) Angiotensin II, cell proliferation and angiogenesis regulator: biologic and therapeutic implications in cancer. Curr Vasc Pharmacol. 2(4): 385-99.