Quick Order

Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TH/Tyrosine Hydroxylase cDNA Clone Product Information
RefSeq ORF Size:1494bp
cDNA Description:Full length Clone DNA of Homo sapiens tyrosine hydroxylase, transcript variant 2 with Flag tag.
Gene Synonym:TYH, TH
Restriction Site:KpnI + PmeI (5.4kb + 1.54kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human TH/Tyrosine Hydroxylase Gene Plasmid Map
Human Tyrosine Hydroxylase transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, C-GFPSpark tagHG10684-ACG$325
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, C-OFPSpark / RFP tagHG10684-ACR$325
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, N-GFPSpark tagHG10684-ANG$325
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, N-OFPSpark / RFP tagHG10684-ANR$325
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, C-Flag tagHG10684-CF$295
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, C-His tagHG10684-CH$295
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, C-Myc tagHG10684-CM$295
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, C-HA tagHG10684-CY$295
Human Tyrosine Hydroxylase transcript variant 2 Gene cDNA clone plasmidHG10684-M$195
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, N-Flag tagHG10684-NF$295
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, N-His tagHG10684-NH$295
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, N-Myc tagHG10684-NM$295
Human Tyrosine Hydroxylase transcript variant 2 ORF mammalian expression plasmid, N-HA tagHG10684-NY$295
Human Tyrosine Hydroxylase transcript variant 2 natural ORF mammalian expression plasmidHG10684-UT$295
 Learn more about expression Vectors
Product nameProduct name

Tyrosine hydroxylase (TH) is a rate-limiting enzyme in catecholamine synthesis. Tyrosine hydroxylase activity is modulated by protein-protein interactions with enzymes in the same pathway or the tetrahydrobiopterin pathway, structural proteins considered to be chaperones that mediate the neuron's oxidative state. It is phosphorylated at serine (Ser) residues Ser8, Ser19, Ser31 and Ser40 in vitro. The phosphorylation of tyrosine hydroxylase at Ser19 or Ser8 has no direct effect on tyrosine hydroxylase activity. As tyrosine hydroxylase (TH) catalyses the formation of L-DOPA, the rate-limiting step in the biosynthesis of DA, the Parkinson's disease (PD) can be considered as a TH-deficiency syndrome of the striatum. A direct pathogenetic role of TH has also been suggested, as the enzyme is a source of reactive oxygen species (ROS) in vitro and a target for radical-mediated oxidative injury. Recently, it has been demonstrated that L-DOPA is effectively oxidized by mammalian Tyrosine hydroxylase in vitro, possibly contributing to the cytotoxic effects of DOPA.

  • Daubner SC, et al. (2011) Tyrosine hydroxylase and regulation of dopamine synthesis. Arch Biochem Biophys. 508(1): 1-12.
  • Dunkley PR, et al. (2004) Tyrosine hydroxylase phosphorylation: regulation and consequences. J Neurochem. 91(5): 1025-43.
  • Haavik J, et al. (1998) Tyrosine hydroxylase and Parkinson's disease. Mol Neurobiol. 16(3): 285-309.