After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
NEK3cDNA Clone Product Information
cDNA Size:1521
cDNA Description:ORF Clone of Homo sapiens NIMA (never in mitosis gene a)-related kinase 3, transcript variant 2 DNA.
Gene Synonym:HSPK36, MGC29949, NEK3
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1236T/G not causing the amino acid variation.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10675-ACG$345
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10675-ACR$345
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10675-ANG$345
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10675-ANR$345
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10675-CF$315
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10675-CH$315
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10675-CM$315
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10675-CY$315
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone)HG10675-M$295
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone) expression ready, FLAG-taggedHG10675-M-F$495
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10675-NF$315
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10675-NH$315
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10675-NM$315
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10675-NY$315
Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10675-UT$315
 Learn more about expression Vectors
Related Products
Product nameProduct name

NEK3 (NIMA (never in mitosis gene a)-related expressed kinase 3), contains 1 protein kinase domain and is a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. Members of the NEK family of protein kinases share high amino acid homology with NIMA (never in mitosis gene a). NEK3 differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. It is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. NEK3 mRNA can be detected in all the proliferating cell lines with the amount not changing during the cell cycle. Prolactin stimulates interaction between NEK3 and paxillin leading to increased paxillin phosphorylation, Analysis of breast tissue microarrays show a significant up-regulation of NEK3 expression in malignant versus normal specimens. Multiple transcript variants encoding different isoforms have been found for NEK3 gene. NEK3 may play a role in mitotic regulation.

  • Miller SL, et al. (2007) Nek3 kinase regulates prolactin-mediated cytoskeletal reorganization and motility of breast cancer cells. Oncogene. 26(32):4668-78.
  • Hernandez M, et al. (2006) Is there any association between nek3 and cancers with frequent 13q14 deletion?. Cancer Invest. 24(7):682-8.
  • Tanaka K, et al. (1999) Cloning and characterization of the murine Nek3 protein kinase, a novel member of the NIMA family of putative cell cycle regulators. J Biol Chem. 274(19):13491-7.
  • Size / Price
    List Price: $495.00  (Save $180.00)
    Price:$315.00      [How to order]
    Availability5 business days
    • Human NEK3 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items