After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human NCAM1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human NCAM1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001076682.2
RefSeq ORF Size:2286bp
cDNA Description:Full length Clone DNA of Homo sapiens neural cell adhesion molecule 1.
Gene Synonym:CD56, NCAM, MSK39, NCAM1
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-NCAM1-t3
Restriction Site:HindIII + XbaI (5.5kb + 2.29kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 1620 T/G not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human NCAM1 Gene Plasmid Map
Human NCAM1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Background

NCAM1, also known as CD56, is a neural adhesion protein (NCAM) which belongs to the immunoglobulin superfamily. NCAM is involved in neural development and in plasticity in the adult brain. UCHL1 is a novel interaction partner of both NCAM isoforms that regulates their ubiquitination and intracellular trafficking. NCAM1 is a cell adhesion molecule involved in neuron-neuron adhesion, neurite fasciculation, outgrowth of neurites, etc. NCAM1 has also been shown to be involved in the expansion of T cells and dendritic cells which play an important role in immune surveillance.

References
  • Reyes AA. et al., 1991, Mol Cell Biol. 11 (3): 1654-61.
  • Suzuki M. et al., 2003, J Biol Chem. 278 (49): 49459-68.
  • Becker C G. et al., 1996, J Neurosci Res. 45 (2): 143-52.
  • Size / Price
    Catalog: HG10673-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"