Quick Order

Human MST4 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MST4 cDNA Clone Product Information
RefSeq ORF Size:1251bp
cDNA Description:Full length Clone DNA of Homo sapiens serine/threonine protein kinase MST4.
Gene Synonym:MST4, MASK
Restriction Site:KpnI + XbaI (5.5kb + 1.25kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

MST4, also known as mammalian STE20-like protein kinase 4, is a novel member of the germinal center kinase subfamily of human Ste20-like kinases and is closely related to MST3. The 416 amino acid full-length MST4 contains a C-terminal regulatory domain and an N-terminal kinase domain, both of which are required for full activation of the kinase. MST4 is highly expressed in placenta, thymus, and peripheral blood leukocytes. MST4 specifically activates ERK but not JNK or p38 MAPK in transient transfected cells or in stable cell lines, and thus is biologically active in the activation of MEK/ERK pathway mediating cell growth and transformation. Further, MST4 kinase activity is stimulated significantly by epidermal growth factor receptor (EGFR) ligands, which are known to promote growth of certain cancer cells. Accordingly, MST4 have a potential role in signal transduction pathways involved in cancer progression. Three alternatively spliced isoform of MST4 have been isolated, and isoform 3 lacks an exon encoding kinase domain and may function as a dominant-negative regulator of the MST4 kinase.


1. Qian, Z. et al., 2001, J Biol Chem. 276 :22439-45.

2. Lin, JL. et al., 2001, Oncogene. 20: 6559-6569.

3. Sung V, et al., 2003, Cancer research. 63: 3356-63.

4. Ma, X. et al., 2007, Molecular biology of the cell. 18:1965-78.

5. ten Klooster JP, et al., 2009, Developmental cell. 16:551-62.

Size / Price
Catalog: HG10667-M-N
List Price:   (Save )
Price:      [How to order]
AvailabilityIn Stock Shipping instructions