After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PRKD3cDNA Clone Product Information
cDNA Size:2673
cDNA Description:ORF Clone of Homo sapiens protein kinase D3 DNA.
Gene Synonym:EPK2, PKD3, PRKCN, PKC-NU, nPKC-NU, PRKD3
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged on other vectors
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedHG10665-ACG$475
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagHG10665-ACR$475
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedHG10665-ANG$475
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagHG10665-ANR$475
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedHG10665-CF$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedHG10665-CH$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedHG10665-CM$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedHG10665-CY$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone)HG10665-M$145
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-taggedHG10665-M-F$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedHG10665-NF$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedHG10665-NH$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedHG10665-NM$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedHG10665-NY$445
Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedHG10665-UT$445
 Learn more about expression Vectors
Related Products
Product nameProduct name

Serine/threonine-protein kinase D3, also known as Protein kinase C nu type, Protein kinase EPK2, PRKD3, EPK2 and PRKCN, is a cytoplasm and membrane protein which belongs to the protein kinase superfamily, CAMK Ser/Thr protein kinase family and PKD subfamily. PRKD3 / PRKCN contains one PH domain, two phorbol-ester/DAG-type zinc fingers and one protein kinase domain. Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. They also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. PRKD3 / PRKCN converts transient diacylglycerol (DAG) signals into prolonged physiological effects, downstream of PKC. It is involved in resistance to oxidative stress. PRKD3 / PRKCN is activated by DAG and phorbol esters. Phorbol-ester/DAG-type domains 1 and 2 bind both DAG and phorbol ester with high affinity and mediate translocation to the cell membrane. Autophosphorylation of Ser-735 and phosphorylation of Ser-731 by PKC relieves auto-inhibition by the PH domain. PRKD3 / PRKCN can be activated rapidly by the agonists of G protein-coupled receptors. It resides in both cytoplasm and nucleus, and its nuclear accumulation is found to be dramatically enhanced in response to its activation. PRKD3 / PRKCN can also be activated after B-cell antigen receptor (BCR) engagement, which requires intact phospholipase C gamma and the involvement of other PKC family members.

  • Schultz SJ, et al.,1994, Cell Growth Differ. 4 (10): 821-30.
  • Hayashi A, et al., 1999, Biochim Biophys Acta 1450 (1): 99-106.
  • Mayne M, et al., 2000, J. Immunol. 164 (12): 6538-42.
  • Ali A, et al., 2002, Chem. Rev. 101 (8): 2527-40.
  • Size / Price
    List Price: $445.00  (Save $0.00)
    Price:$445.00      [How to order]
    Availability5 business days
    • Human PKC nu / PRKD3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items