Quick Order

Human CaM Kinase 4 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human CAMK4 cDNA Clone Product Information
RefSeq ORF Size:1422bp
cDNA Description:Full length Clone DNA of Homo sapiens calcium/calmodulin-dependent protein kinase IV with Flag tag.
Gene Synonym:CaMK-GR, MGC36771, CAMK4
Restriction Site:KpnI + XhoI (5.4kb + 1.47kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) belongs to the serine/threonine protein kinase family, and to the Ca2+/calmodulin-dependent protein kinase subfamily which is widely recognized as an essential enzyme implicated in the phophoinositide amplification cascade. Ca2+/calmodulin dependent protein kinase (CAMK) can be activated by the introcellular increased Ca2+ and then apt to combine with the target protein. Ca2+/ calmodulin-dependent protein kinase 4 (CAMKⅣ) is a multifunctional CaM-dependent kinase protein with limited tissue distribution, that has been implicated in transcriptional regulation in lymphocytes, neurons and male germ cells. All of the isforms of this family, including myosin light chain kinase, phosphorylase kinase, CaMK1, CaMKⅢ and CaMKⅣ have EF-hand structure.

  • Feliciano DM, et al. (2009) Repression of Ca2+/calmodulin-dependent protein kinase IV signaling accelerates retinoic acid-induced differentiation of human neuroblastoma cells. J Biol Chem. 284 (39): 26466-81.
  • Zhao X, et al. (2001). The modular nature of histone deacetylase HDAC4 confers phosphorylation-dependent intracellular trafficking. J Biol Chem. 276 (37): 35042-8.
  • Racioppi L, et al. (2008) Calcium/calmodulin-dependent kinase IV in immune and inflammatory responses: novel routes for an ancient traveller.
  • Size / Price
    Catalog: HG10664-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions