Quick Order

Text Size:AAA

Human C5 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human C5 cDNA Clone Product Information
RefSeq ORF Size:5031bp
cDNA Description:Full length Clone DNA of Homo sapiens component 5 with Flag tag.
Gene Synonym:CPAMD4, FLJ17816, FLJ17822, MGC142298
Restriction Site:KpnI (three restriction sites) + XhoI (5.4kb + 2.86kb + 0.54kb + 1.68kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 1632 C/T not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human C5 Gene Plasmid Map
Human C5 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

C5a is a protein fragment released from complement component C5. This 74 amino acid peptide in humans is generated by the cleavage of C5a convertase on the C5 α-chain during the classical, alternative, and lectin pathways of complement activation. The structure of C5a includes a core region consisting of four, anti-parallel alpha-helices held together by three disulfide linkages and a structured C-terminal tail, and C5a is rapidly metabolised by carboxypeptidase B to a 73 amino acid low activity form, C5a des-Arg. C5a is an extremely potent proinflammatory mediator, as well as a potent chemotactic factor for neutrophils and other leukocytes. It causes histamine release, increases in vascular permeability, induces several cytokines production from leukocytes, enhances neutrophil-endothelial cell adhesion, and augments the humoral and cell-mediated immune response. C5a is quickly metabolised by carboxypeptidases, forming the less potent C5adesArg. Acting via a classical G protein-coupled receptor, CD88, C5a and C5adesArg exert a number of effects essential to the innate immune response, while their actions at the more recently discovered non-G protein-coupled receptor, C5L2 (or GPR77), remain unclear. The widespread expression of C5a receptors throughout the body allows C5a to elicit a broad range of effects. Thus, C5a has been found to be a significant pathogenic driver in a number of immuno-inflammatory diseases, making C5a inhibition an attractive therapeutic strategy. C5a is a strong chemoattractant and is involved in the recruitment of inflammatory cells such as neutrophils, eosinophils, monocytes, and T lymphocytes, in activation of phagocytic cells and release of granule-based enzymes and generation of oxidants, all of which may contribute to innate immune functions or tissue damage. Accordingly, the anaphylatoxin C5a is implicated in a variety of diseases such as rheumatoid arthritis, systemic lupus erythematosus, reperfusion injury, Alzheimer's disease, and sepsis.

  • Guo RF, et al.. (2005) Role of C5a in inflammatory responses. Annu Rev Immunol. 23: 821-52.
  • Guo RF, et al. (2006) C5a, a therapeutic target in sepsis. Recent Pat Antiinfect Drug Discov. 1(1): 57-65.
  • Manthey HD, et al. (2009) Complement component 5a (C5a). Int J Biochem Cell Biol. 41(11): 2114-7.
  • Size / Price
    Catalog: HG10608-M-F
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions