Quick Order

Text Size:AAA

Human LOX-1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human OLR1/LOX1 cDNA Clone Product Information
RefSeq ORF Size:822bp
cDNA Description:Full length Clone DNA of Homo sapiens oxidized low density lipoprotein (lectin-like) receptor 1.
Gene Synonym:LOX1, CLEC8A, SCARE1
Restriction Site:BamHI + XbaI (5.5kb + 0.82kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Oxidized low-density lipoprotein receptor 1 (Ox-LDL receptor 1 or OLR1), also known as lectin-type oxidized LDL receptor 1 (LOX1), is a receptor protein that belongs to the C-type lectin superfamily. LOX1 is a multi-ligand receptor originally identified as the endothelial oxidized LDL receptor. OLR1 / LOX1 was isolated from an aortic endothelial cell, and recently it has been discovered in macrophages and vascular smooth muscle cells in artery vessels. The expression of LOX1 is inducted by inflammatory stimuli and oxidative stimuli. This protein binds, internalizes and degrades oxidized low-density lipoprotein. LOX1 may play an important role in the progression of vulnerable carotid plaque and might regulate vulnerable plaque formation in cooperation with MMPs and TIMP-2. In clinical, LOX1 is thought to be involved in the development of atherosclerotic lesions. 

  • Hinagata J, et al. (2006) Oxidized LDL receptor LOX-1 is involved in neointimal hyperplasia after balloon arterial injury in a rat model. Cardiovasc Res. 69 (1): 263-71.
  • Melan MA, et al. (1994) The LOX1 Gene of Arabidopsis Is Temporally and Spatially Regulated in Germinating Seedlings. Plant Physiol. 105 (1): 385-93.
  • Saito A, et al. (2010) Relationship between lectin-like oxidized low-density lipoprotein receptor 1 expression and preoperative echogenic findings of vulnerable carotid plaque. Acta Neurochir (Wien). 152 (4): 589-95.
  • Size / Price
    Catalog: HG10585-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions