Quick Order

Human VEGF-B ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human VEGF-B cDNA Clone Product Information
Gene_bank_ref_id:NM_003377.3
RefSeq ORF Size:624bp
cDNA Description:Full length Clone DNA of Homo sapiens vascular endothelial growth factor B with Flag tag.
Gene Synonym:VRF, VEGFL, VEGFB
Species:Human
Vector:pCMV2-FLAG
Plasmid:pCMV2-VEGFB-flag
Restriction Site:HindIII + XhoI (5.4kb + 0.67kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human VEGF-B Gene Plasmid Map
Human VEGF-B Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV2-FLAG Vector Information
 
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Human VEGFR1 / FLT-1 Protein (Fc Tag)Human PIGF / PLGF Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human Neuropilin-1 / NRP1 Protein (Fc Tag)Human Neuropilin-2 / NRP2 Protein (His Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human VEGF-C Protein (His Tag)Human VEGF-D / VEGFD / FIGF Protein (His Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinHuman VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human VEGFR3 / FLT4 Protein (Fc Tag)Human VEGF-B / VEGFB Protein (Fc Tag)Mouse VEGFA / VEGF164 ProteinHuman VEGF121 / VEGF-A ProteinMouse VEGFR3 / FLT-4 Protein (His Tag)Mouse VEGFR3 / FLT-4 Protein (Fc Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human Neuropilin-1 / NRP1 / CD304 Protein (His Tag)Mouse PIGF / PLGF Protein (Fc Tag)Rat VEGF164 / VEGFA ProteinMouse VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGF121 / VEGF-A ProteinMouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human / Cynomolgus VEGF / VEGFA / VEGF165 ProteinDanio rerio (zebrafish) VEGF / VEGFA / VEGF165 ProteinMouse VEGF-D / VEGFD / FIGF Protein (His Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, Fc Tag)Rat VEGFC / VEGF-C Protein (aa 108-223, His Tag)Rat VEGF-D / VEGFD / FIGF Protein (Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR1 / FLT-1 Protein (His Tag)Mouse PIGF / PLGF ProteinHuman VEGF121b / VEGF-A ProteinCanine VEGF / VEGFA ProteinHuman Neuropilin 2 / NRP2 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 Protein (Fc Tag)Cynomolgus Neuropilin-1 / NRP1 Protein
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"