After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific PreferencesReviewsResearch TopicsProtocols
CCL20cDNA Clone Product Information
Gene Bank Ref.ID:
cDNA Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping Carrier:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Chemokine & Receptor Related Products
Product nameProduct name
Canine XCL1 Protein (His Tag)Human CXCL2 / MIP-2 ProteinRat CXCL1 / MGSA / NAP-3 ProteinRat CXCL2 / MIP-2 ProteinHuman CCL20 / MIP-3 alpha Protein (His Tag)Rat CCL3 / Mip1a ProteinHuman FAM19A4 / TAFA4 Protein (Fc Tag)Human CCL2 / MCP-1 / MCP1 Protein (His Tag)Human CCL23 / MIP 3 Protein (His Tag)Mouse NAP-2 / PPBP / CXCL7 Protein (aa 49-109, His Tag)Mouse NAP-2 / PPBP / CXCL7 Protein (aa 40-113, His Tag)Mouse CCL22 / MDC Protein (His Tag)Mouse CXCL14 / BRAK ProteinMouse CXCL1 / MGSA / NAP-3 ProteinHuman NAP-2 / PPBP / CXCL7 Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human I-309 / CCL1 / TCA-3 Protein (Fc Tag)Human I-309 / CCL1 / TCA-3 ProteinHuman CCL13 / MCP-4 Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99)Human CXCL12 / SDF1b Protein (Fc Tag)Human CXCL12 / SDF-1 ProteinHuman CCL18 / PARC / MIP4 Protein (His Tag)Human CCL22 / MDC Protein (His Tag)Human CCL17 / TARC / SCYA17 Protein (His Tag)Human CCL17 / TARC / SCYA17 ProteinHuman CCL11 Protein (His Tag)Human CCL14 / HCC-1 / HCC-3 Protein (His Tag)Human CCL14 / HCC-1 / HCC-3 Protein (aa 28-93, His Tag)Human CCL21 / 6Ckine ProteinMouse CCL2 / MCP-1 / MCP1 Protein (His Tag)Human CCL27 / CTACK Protein (His Tag)Human Fractalkine / CX3CL1 Protein (His Tag)Human XCL1 Protein (His Tag)Human CXCL10 / Crg-2 ProteinHuman CXCL4 / PF4 ProteinHuman CXCL1 / MGSA / NAP-3 Protein (His & NusA Tag)Human CXCL1 / MGSA / NAP-3 Protein (His & SUMO Tag)Human CXCL14 / BRAK ProteinHuman CXCL9 / MIG / C-X-C motif chemokine 9 ProteinHuman CXCL5 ProteinHuman CCL15 / MIP-5 / MIP-1 delta Protein (aa 22-113, His Tag)Human CCL15 / MIP-5 / MIP-1 delta Protein (aa 46-113, His Tag)Human CCL5 / RANTES Protein (His & mucin Tag)Human CCL24 / Eotaxin-2 / MPIF-2 Protein (His Tag)Human CCL8 / MCP-2 Protein (SUMO Tag)Human CCL16 / HCC-4 / NCC4 Protein (His Tag)Human CCL16 / HCC-4 / NCC4 Protein (His Tag)Human CCL4 / MIP1B Protein (His Tag)Human CCL3 / Mip1a Protein (His Tag)Human CXCL3 / GRO gamma Protein (His Tag)Human FAM19A2 Protein (Fc Tag)Human MCP-3 / CCL7 Protein (His Tag)Human MCP-3 / CCL7 Protein (His Tag)Cynomolgus / Rhesus Fractalkine / CX3CL1 Protein (Fc Tag)Human XCL2 Protein (His Tag)Human CXCL12 / SDF-1 Protein (isoform a, His Tag)Human CXCL12 / SDF-1 Protein (isoform a)Human CXCL1 / MGSA / NAP-3 ProteinMouse CXCL12 / SDF-1 ProteinMouse CCL6 / C-C motif ligand 6 Protein (His Tag)Mouse CCL17 / TARC ProteinMouse CCL20 / MIP-3 alpha Protein (His Tag)Mouse CXCL2 / GRO2 / MIP-2 (His & SUMO Tag)Mouse CXCL16 / SR-PSOX Protein (His Tag)Mouse CXCL9 / MIG / C-X-C motif chemokine 9 ProteinMouse I-309 / CCL1 / TCA-3 Protein (Fc Tag)Mouse CCL8 / MCP-2 Protein (His & NusA Tag)Mouse XCL1 Protein (His Tag)Human CCL28 Protein (His Tag)Mouse CCL3 / Mip1a ProteinCanine IL-8 / CXCL8 ProteinCanine CXCL12 / SDF-1 ProteinCanine CXCL13 / BCA-1 Protein (His Tag)Canine CXCL16 / SR-PSOX Protein (His Tag)Rat NAP-2 / PPBP / CXCL7 Protein (Fc Tag)Rat CXCL16 / SR-PSOX Protein (Fc Tag)Rat CXCL16 / SR-PSOX Protein (His Tag)Cynomolgus CXCL12 / SDF-1 Protein (Fc Tag)Cynomolgus CXCL13 / BCA-1 / BLC Protein (His Tag)Cynomolgus CCL17 / TARC Protein (His Tag)Cynomolgus XCL1 Protein (His Tag)Cynomolgus NAP-2 / PPBP / CXCL7 Protein (Fc Tag)Cynomolgus CXCL9 / MIG / C-X-C motif chemokine 9 ProteinCynomolgus CCL21 / 6Ckine ProteinCynomolgus IL-8 / CXCL8 ProteinMouse MCP-3 / CCL7 Protein (His Tag)Human CCL5 / RANTES ProteinHuman CCL23 / MIP 3 Protein (His Tag)Human CCL23 / MIP 3 ProteinCanine CXCL16 / SR-PSOX Protein (Fc Tag)Canine Fractalkine / CX3CL1 Protein (Fc Tag)Canine Fractalkine / CX3CL1 Protein

Chemokine (C-C motif) ligand 20 (CCL20) or liver activation regulated chemokine (LARC) or Macrophage Inflammatory Protein-3 (MIP3A) is a small cytokine belonging to the CC chemokine family that attracts immature dendritic cells and memory T lymphocytes, both expressing CCR6. Depending on the cell type, this chemokine was found to be inducible by cytokines (IL-1beta) and by bacterial, viral, or plant products (including LPS, dsRNA, and PMA). MIP3A / CCL20 is Expressed predominantly in the liver, lymph nodes, appendix, peripheral blood lymphocytes, and fetal lung. Low levels of MIP3A / CCL20 has been seen in thymus, prostate, testis, small intestine and colon. As a chemotactic factor, MIP3A / CCL20 attracts lymphocytes and, slightly, neutrophils, but not monocytes. This chemokine may Inhibit proliferation of myeloid progenitors in colony formation assays and it may be involved in formation and function of the mucosal lymphoid tissues by attracting lymphocytes and dendritic cells towards epithelial cells. Its C-terminal processed forms have been shown to be equally chemotactically active for leukocytes. Chemokine CCL20 was shown to play a role in colorectal cancer (CRC) pathogenesis.

  • Vicinus B, et al. (2012) miR-21 functionally interacts with the 3'UTR of chemokine CCL20 and down-regulates CCL20 expression in miR-21 transfected colorectal cancer cells. Cancer Lett. 316(1): 105-12.
  • Ding X, et al. (2012) High Expression of CCL20 Is Associated with Poor Prognosis in Patients with Hepatocellular Carcinoma after Curative Resection. J Gastrointest Surg. 16(4): 828-36.
  • Ivison SM, et al. (2010) Oxidative stress enhances IL-8 and inhibits CCL20 production from intestinal epithelial cells in response to bacterial flagellin. Am J Physiol Gastrointest Liver Physiol. 299(3): 733-41.
  • Size / Price
    • Human CCL20 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items