Quick Order

Human TNFRSF4 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TNFRSF4/OX40/CD134 cDNA Clone Product Information
RefSeq ORF Size:834bp
cDNA Description:Full length Clone DNA of Homo sapiens tumor necrosis factor receptor superfamily, member 4.
Gene Synonym:OX40, ACT35, CD134, TXGP1L, TNFRSF4
Restriction Site:KpnI + XhoI (5.5kb + 0.83kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutation 534 G/A not causing the amino acid variation.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Human 4-1BBL / CD137L Protein (Fc Tag, ECD)Human GITR / TNFRSF18 Protein (His Tag, ECD)Canine CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Human TL1A / TNFSF15 Protein (Fc Tag)Cynomolgus LTB / TNFSF3 / Lymphotoxin beta Protein (His Tag)Cynomolgus TNFRSF21 / DR6 Protein (His Tag)Cynomolgus TNF-alpha / TNFA ProteinHuman XEDAR / EDA2R Protein (Fc Tag)Cynomolgus XEDAR / EDA2R Protein (ECD, His Tag)Human CD40 / TNFRSF5 Protein (ECD, Fc Tag)Rabbit NGFR / TNFRSF16 / P75 Protein (ECD, His Tag)Cynomolgus RANKL / OPGL / TNFSF11 Protein (Fc Tag)Rhesus OX40 / CD134 Protein (Fc Tag)Rhesus CD137 / 4-1BB Protein (Fc Tag)Mouse TNFSF12 Protein (Fc Tag)Human TNFRSF17 / BCMA / CD269 Protein (Fc Tag)Rhesus CD137 / 4-1BB Protein (His Tag)Canine BLyS / TNFSF13B / BAFF Protein (Fc Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 ProteinHuman CD137 / 4-1BB / TNFRSF9 Protein (His & Fc Tag)Human CD27 / TNFRSF7 Protein (His & Fc Tag)Human CD153 / CD30L / TNFSF8 Protein (Fc Tag)Human CD40 / TNFRSF5 Protein (His & Fc Tag)Human DR6 / TNFRSF21 Protein (Fc Tag)Human DR6 / TNFRSF21 ProteinHuman FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Human HVEM / TNFRSF14 Protein (His & Fc Tag)Human TNFSF14 / LIGHT / CD258 Protein (His Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His & Fc Tag)Human TNFRSF4 / OX40 / CD134 Protein (His & Fc Tag)Human TNF-alpha / TNFA ProteinHuman TRAIL R1 / CD261 / TNFRSF10A Protein (His & Fc Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His & Fc Tag)Mouse 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (Fc Tag)Human CD30 / TNFRSF8 Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His & Fc Tag)Human RELT / TNFRSF19L Protein (His & Fc Tag)Human CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human CD40 / TNFRSF5 Protein (His Tag)Human TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TNFRSF17 / BCMA Protein (His & Fc Tag)Mouse TNFRSF19 / TROY Protein (His & Fc Tag)Human BLyS / TNFSF13B / BAFF Protein (Fc Tag)Mouse TNF-alpha / TNFA ProteinHuman DR6 / TNFRSF21 Protein (His Tag)Human TNFRSF17 / BCMA / CD269 Protein (His & Fc Tag)Mouse CD27 / TNFRSF7 Protein (His & Fc Tag)Human TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Mouse TNFRSF19 / TROY Protein (His Tag)Mouse DR6 / TNFRSF21 Protein (His Tag)Human TNFRSF4 / OX40 / CD134 Protein (His Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Mouse FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Human RELT / TNFRSF19L Protein (His Tag)Mouse CD27 / TNFRSF7 Protein (His Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His Tag)Mouse TRAIL R2 / CD262 / TNFRSF10B Protein (His & Fc Tag)Human TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Canine TNF-alpha / TNFA / TNFSF1A ProteinHuman EDAR / DL Protein (Fc Tag)Human EDAR / DL Protein (His Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Mouse TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Human FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (Fc Tag)Human TRAIL R1 / CD261 / TNFRSF10A Protein (His Tag)Human Osteoprotegerin / TNFRSF11B Protein (His Tag)Human CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Human HVEM / TNFRSF14 Protein (His Tag)Human TNFRSF25 / DR3 / TNFRSF12 Protein (Fc Tag)Human CD40L / CD154 / TNFSF5 Protein (His Tag)Human CD30 / TNFRSF8 Protein (His Tag)Human BLyS / TNFSF13B / BAFF ProteinHuman XEDAR / EDA2R Protein (His Tag)Human CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (His Tag)Cynomolgus / Rhesus TNF-alpha / TNFA / TNFSF1A / Cachectin ProteinHuman TNFRSF13B / TACI / CD267 Protein (His Tag)Human TNF-beta / TNFSF1 / Lymphotoxin alpha ProteinMouse PGLYRP1 / PGRP-S Protein (His Tag)Mouse BAFFR / TNFRSF13C / CD268 Protein (Fc Tag)Rat TNF-alpha / TNFA ProteinFerret TNF-alpha / TNFA ProteinHuman TNFSF10 / TRAIL / APO-2L / CD253 ProteinMouse CD40 / TNFRSF5 Protein (His & Fc Tag)Mouse CD137 / 4-1BB / TNFRSF9 Protein (Fc Tag)Mouse TNFRSF4 / OX40 / CD134 Protein (Fc Tag)Mouse TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Mouse NGFR / P75 Protein (His Tag)Human OX-40L / TNFSF4 / CD252 Protein (Fc Tag)Mouse NGFR / P75 Protein (Fc Tag)Human NGFR / P75 Protein (Fc Tag)Human NGFR/ P75 Protein (His Tag)Mouse RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Human TNFRSF12A / FN14 / TWEAKR Protein (Fc Tag)Rat LTBR / TNFRSF3 Protein (His Tag)Human BLyS / TNFSF13B / BAFF ProteinMouse TNFSF10 / TRAIL / APO-2L Protein (aa 118-291, His Tag)Mouse CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat EDAR Protein (Fc Tag)Rat TNFRSF11A Protein (His Tag)Rat TNFRSF17 / BCMA Protein (Fc Tag)Rat XEDAR / EDA2R Protein (Fc Tag)Rhesus TNFSF10 / TRAIL / APO-2L ProteinRat 4-1BBL / CD137L / TNFSF9 Protein (Fc Tag)Rat 4-1BBL / CD137L / TNFSF9 Protein (His Tag)Rat TNFRSF11A Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (Fc Tag)Rat XEDAR / EDA2R Protein (His Tag)Rat TNFSF15 / TL1A Protein (Fc Tag)Human CD27 / TNFRSF7 Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (His Tag)Mouse TNFSF13 Protein (Fc Tag)Mouse XEDAR / EDA2R Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (Fc Tag)Rat CD70 / CD27L / TNFSF7 Protein (His Tag)Human TNFRSF19 / TROY Protein (Fc Tag)Rat CD40 / TNFRSF5 Protein (His Tag)Rhesus CD40 / TNFRSF5 Protein (Fc Tag)Rhesus CD40 / TNFRSF5 Protein (His Tag)Rhesus TNFRSF17 / BCMA Protein (Fc Tag)Rat GITR / TNFRSF18 Protein (Fc Tag)Rat CD153 / CD30L / TNFSF8 Protein (Fc Tag)Cynomolgus LTBR / TNFRSF3 Protein (Fc Tag)Cynomolgus EDAR Protein (Fc Tag)Rat CD40L / CD154 / TNFSF5 Protein (Fc Tag)Rat TNFSF12 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (Fc Tag)Rhesus TRAIL R4 / CD264 / TNFRSF10D Protein (Fc Tag)Rhesus TRAIL R4 / CD264 / TNFRSF10D Protein (His Tag)Rhesus Osteoprotegerin / TNFRSF11B Protein (Fc Tag)Human CD153 / CD30L / TNFSF8 ProteinHuman RANKL / OPGL / TNFSF11 / CD254 ProteinRhesus CD27 / TNFRSF7 Protein (Fc Tag)Cynomolgus / Human TNFSF12 Protein (Fc Tag)Human CD27 / TNFRSF7 Protein (His Tag)Human GITR / TNFRSF18 Protein (Fc Tag)Rat FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Cynomolgus CD153 / CD30L / TNFSF8 Protein (His Tag)Cynomolgus HVEM / TNFRSF14 Protein (Fc Tag)Human DCR3 / TNFRSF6B Protein (Fc Tag)Mouse HVEM / TNFRSF14 Protein (His & Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Rat TNFR1 / CD120a / TNFRSF1A Protein (His Tag)Rhesus CD40L / CD154 / TNFSF5 Protein (Fc Tag)Human TNFRSF19 / TROY Protein (His Tag)Rat CD153 / CD30L / TNFSF8 ProteinRat LTBR / TNFRSF3 Protein (Fc Tag)Cynomolgus TNFR2 / CD120b / TNFRSF1B Protein (Fc Tag)Cynomolgus EDAR Protein (His Tag)Cynomolgus BLyS / TNFSF13B / BAFF Protein (Fc Tag)Human RANKL / OPGL / TNFSF11 / CD254 Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (His Tag)Cynomolgus XEDAR / EDA2R Protein (Fc Tag)Canine CD137 / 4-1BB / TNFRSF9 Protein (His Tag)Cynomolgus FAS / CD95 / APO-1 / TNFRSF6 Protein (Fc Tag)Cynomolgus OX-40L / TNFSF4 Protein (Fc Tag)Human TNFR2 / CD120b / TNFRSF1B Protein (aa 1-268, 196 Met/Arg, His Tag)Canine CD40 / TNFRSF5 Protein (Fc Tag)Rat BAFFR / TNFRSF13C Protein (Fc Tag)Canine CD40 / TNFRSF5 ProteinHuman Fas Ligand / FASLG / CD95L Protein (His Tag)Canine CD40L / CD154 / TNFSF5 Protein (Fc Tag)Canine CD40L / CD154 / TNFSF5 ProteinCanine CD40 / TNFRSF5 Protein (His Tag)Human TNFRSF11A Protein (Fc Tag)Mouse CD70 / CD27L / TNFSF7 Protein (Fc Tag)Human TNF-alpha / TNFA Protein (Fc Tag)Human TNFRSF11A Protein (His Tag)Mouse Osteoprotegerin / TNFRSF11B Protein (Fc Tag)

OX40 (CD134) and its binding partner, OX40L (CD252), are members of the tumor necrosis factor receptor/tumor necrosis factor superfamily, is known to break an existing state of tolerance in malignancies, leading to a reactivation of antitumor immunity. The interaction between OX40 and OX40L plays an important role in antigen-specific T-cell expansion and survival. OX40 and OX40L also regulate cytokine production from T cells, antigen-presenting cells, natural killer cells, and natural killer T cells, and modulate cytokine receptor signaling. In line with these important modulatory functions, OX40-OX40L interactions have been found to play a central role in the development of multiple inflammatory and autoimmune diseases, making them attractive candidates for intervention in the clinic. Conversely, stimulating OX40 has shown it to be a candidate for therapeutic immunization strategies for cancer and infectious disease.

  • Compaan D.M., et al. (2006) .The crystal structure of the costimulatory OX40-OX40L complex. Structure 14:1321-1330.
  • Kawamata S., et al. (1998) .Activation of OX40 signal transduction pathways leads to tumor necrosis factor receptor-associated factor (TRAF) 2- and TRAF5-mediated NF-kappaB activation. J. Biol. Chem. 273:5808-5814.
  • Byun M., (2013) Inherited human OX40 deficiency underlying classic Kaposi sarcoma of childhood. J. Exp. Med. 210:1743-1759.
  • Size / Price
    Catalog: HG10481-G-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions