Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MMP-3 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Promoter:
Application:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human MMP-3 Gene Plasmid Map
Human MMP-3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Matrix metallopeptidase 3 (abbreviated as MMP3) is also known as stromelysin 1 and progelatinase. MMP3 is a member of the matrix metalloproteinase (MMP) family whose members are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, tissue remodeling, and disease processes including arthritis and metastasis. As a secreted zinc-dependent endopeptidase, MMP3 exerts its functions mainly in extracellular matrix. This protein is activated by two major endogenous inhibitors: alpha2-macroglobulin and tissue inhibitors of metalloproteases (TIMPs). MMP3 plays a central role in degrading collagen types II, III, IV, IX, and X, proteoglycans, fibronectin, laminin, and elastin. In addition, MMP3 can also active other MMPs such as MMP1, MMP7, and MMP9, rendering MMP3 crucial in connective tissue remodeling. Dysregulatoin of MMPs has been implicated in many diseases including arthritis, chronic ulcers, encephalomyelitis and cancer. Synthetic or natural inhibitors of MMPs result in inhibition of metastasis, while up-regulation of MMPs led to enhanced cancer cell invasion.

References
  • Sternlicht MD, et al. 1999, The stromal proteinase MMP3/stromelysin-1 promotes mammary carcinogenesis. Cell. 98(2): 137-46.
  • Yoon S, et al. (1999) Genetic analysis of MMP3, MMP9, and PAI-1 in Finnish patients with abdominal aortic or intracranial aneurysms. Biochem Biophys Res Commun. 265(2): 563-8.
  • Biondi ML, et al. (2000) MMP1 and MMP3 polymorphisms in promoter regions and cancer. Clin Chem. 46(12): 2023-4.
  • Images
    • Human MMP-3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"