After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RTN4RcDNA Clone Product Information
Gene_bank_ref_id:
cDNA Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Background

Reticulon 4 receptor (RTN4R), also known as Nogo-66 Receptor (NgR), is a glycosylphosphoinositol (GPI)-anchored protein that belongs to the Nogo recptor family including three members. Mouse RTN4R cDNA contains 10 LRP (Leucine-rich) repeats. RTN4R is expressed predominantly in neurons and their axons in the central nervous systems (CNS). As a receptor for myelin-derived proteins Nogo, myelin-associated glycoprotein (MAG), and myelin oligodendrocyte glycoprotein (OMG), RTN4R mediates axonal growth inhibition and may play a role in regulating axonal regeneration and plasticity in the adult CNS. It has been shown that RTN4R performs its inhibitory actions by interacting with the p75 neurotrophin receptor (p75NTR), a TNFRSF member also known for modulating the activities of the Trk family and for inducing apoptosis in neurons and oligodendrocytes. RTN4R may be proposed as a potential drug target for treatment of various neurological conditions such as spinal cord injury, CNS lesions, peripheral nerve injury, stroke and Alzheimer's disease (AD). Additionally, RTN4R may play a role in regulating the function of the gap junctions.

References

1. Wang, X. et al., 2006, Ann Neurol. 60(5): 540-549.      

2. Wang, Y.Z. et al., 2006, Neuroreport.17(6):605-609.       

3. Zhu, H.Y. et al., 2007, Hum Pathol. 38(3): 426-434.           

4. David, S. et al., 2008, Trends Neurosci. 31(5): 221-226.       

5. Jiang, W. et al., 2009, Transl Res. 154(1): 40-48.      

6. Zhang, L. et al., 2009, J Neurosci, 9(19): 6348-6352.

Size / Price
Images
  • Human RTN4R / NOGOR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"