After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BCL2L1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human Bcl-XL/BCL2L1 cDNA Clone Product Information
RefSeq ORF Size:702bp
cDNA Description:Full length Clone DNA of Homo sapiens BCL2-like 1.
Gene Synonym:BCLX, BCL2L, Bcl-X, bcl-xL, bcl-xS, BCL-XL/S, DKFZp781P2092, BCL2L1
Restriction Site:NheI + XbaI (5.5kb + 0.7kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

B-cell lymphoma-extra large (Bcl-xl) is a transmembrane molecule in the mitochondria. Bcl-xL (BCL2L1) , belongs to the Bcl-2 family. Members of the bcl-2 family encode proteins that function either to promote or to inhibit apoptosis. Antiapoptotic members such as Bcl-2 and Bcl-xL prevent PCD in response to a wide variety of stimuli to take part in cancer survival. Conversely, proapoptotic proteins, exemplified by Bax and Bak, can accelerate death and in some instances are sufficient to cause apoptosis independent of additional signals. The crystal and solution structures of a Bcl-2 family member, Bcl-xL is like this: The structures consist of two central, primarily hydrophobic α-helices, which are surrounded by amphipathic helices. A 60-residue loop connecting helices αl and α2 was found to be flexible and non-essential for anti-apoptotic activity. Bcl-xL is chareacterized as important factors in autophagy, inhibiting Beclin 1-mediated autophagy by binding to Beclin 1. In addition, Beclin 1, Bcl-2 and Bcl-xL can cooperate with Atg5 or Ca2+ to regulate both autophagy and apoptosis. Bcl-xL is also implicated in anoxia induced cell death. The pathway is initiated by the loss of function of the prosurvival Bcl-2 family members Mcl-1 and Bcl-2 / Bcl-XL, resulting in Bax- or Bak-dependent release of cytochrome c and subsequent caspase-9-dependent cell death. Thus, Bcl-xL, the well-characterized apoptosis guards, appears to be important in cell death.

  • Vander Heiden MG, et al. (1997) Bcl-xL Regulates the Membrane Potential and Volume Homeostasis of Mitochondria. Cell. 91 (5): 627-37.
  • Muchmore SW, et al. (1996) X-ray and NMR structure of human Bcl-xL, an inhibitor of programmed cell death. Nature. 381: 335-341.
  • SharoffEH, et al. (2007) Bcl-2 family members regulate anoxia-induced cell death. Antioxid Redox Signal. 9 (9) :1405-9.
  • Zhou F, et al. (2011) Bcl-2 and Bcl-xL play important roles in the crosstalk between autophagy and apoptosis. FEBS J. 278 (3): 403-13.
  • Size / Price
    Catalog: HG10455-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions