After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ARSA natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ARSA cDNA Clone Product Information
RefSeq ORF Size:1524bp
cDNA Description:Full length Clone DNA of Homo sapiens arylsulfatase A.
Gene Synonym:MLD, ARSA
Restriction Site:HindIII + XbaI (5.5kb + 1.52kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Arylsulfatase A (ARSA) is synthesized as a 52KDa lysosomal enzyme. It is a member of the sulfatase family that is required for the lysosomal degradation of cerebroside-3-sulfate, a sphingolipid sulfate ester and a major constituent of the myelin sheet. Arylsulfatase A is activated by a required co- or posttranslational modification with the oxidation of cysteine to formylglycine. Metachromatic leukodystrophy (MLD) is a lysosomal storage disease in the central and peripheral nervous systems with severe and progressive neurological symptoms caused by the deficiency of Arylsulfatase A. Deficiency of this enzyme is also found in apparently healthy individuals, a condition for which the term pseudodeficiency is introduced. ARSA forms dimers after receiving three N-linked oligosaccharides in the endoplasmic reticulum, and then the dimers are transported to the Golgi where they receive mannose 6-phosphate recognition markers. And thus, ARSA is transported and delivered to dense lysosomes in a mannose 6-phosphate receptor-dependent manner. It has been shown that within the lysosomes, the ARSA dimers can oligomerize to an octamer in a pH-dependent manner. The ARSA deficiency leads to metachromatic leucodystrophy (MLD), a lysosomal storage disorder associated with severe and progressive demyelination in he central and peripheral nervous system. Additionally, the serum level of arylsulfatase A might be helpful in diagnosis of lung and central nervous system cancer.

  • Laidler PM. (1991) Arylsulfatase A--physico-chemical properties and the use of enzyme radioimmunoassay in medical diagnosis Folia Med Cracov. 32(3-4): 149-68.
  • Jean S, et al. (2006) Ethanol decreases rat hepatic arylsulfatase A activity levels. Alcohol Clin Exp Res. 30(11): 1950-5.
  • Size / Price
    Catalog: HG10449-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions