Quick Order

Human TPOR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TPOR/MPLcDNA Clone Product Information
cDNA Size:1908
cDNA Description:ORF Clone of Homo sapiens myeloproliferative leukemia virus oncogene DNA.
Gene Synonym:MPLV, TPOR, C-MPL, CD110, MPL
Restriction Site:HindIII + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name

CD110, also known as c-MPL, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs. It is expressed at a low level in a large number of cells of hematopoietic origin. C-MPL is homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. Thrombopoietin is the ligand for c-mpl. It was shown to be the major regulator of megakaryocytopoiesis and platelet formation. Defects in c-MPL are a cause of congenital amegakaryocytic thrombocytopeniawhich is a disease characterized by isolated thrombocytopenia and megakaryocytopenia with no physical anomalies. Defects in c-MPL also cause thrombocythemia type 2 and myelofibrosis with myeloid metaplasia.

Size / Price
List Price: $315.00  (Save $0.00)
Price:$315.00      [How to order]
Availability5 business days
  • Human TPOR Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Recently Viewed Items