Quick Order

Human INHBA ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human INHBA cDNA Clone Product Information
RefSeq ORF Size:1281bp
cDNA Description:Full length Clone DNA of Homo sapiens inhibin, beta A with Flag tag.
Gene Synonym:EDF, FRP, INHBA
Restriction Site:NheI + XhoI (5.5kb + 1.31kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.


Activin and inhibin are two closely related protein complexes that have almost directly opposite biological effects. The activin and inhibin protein complexes are both dimeric in structure, and, in each complex, the two monomers are linked to one another by a single disulfide bond. Activin is composed of two β subunits, βA βA (activin A), βB βB (activin B), or βA βB (activin AB). Inhibin is composed of an alpha and one of two β subunits, βA (inhibin A) or βB (inhibin B). Activins are produced in many cell types and organs, such as gonads, pituitary gland, and placenta. In the ovarian follicle, activin increases FSH binding and FSH-induced aromatization. It participates in androgen synthesis enhancing LH action in the ovary and testis. In the male, activin enhances spermatogenesis. In addition, Activin plays a role in wound repair and skin morphogenesis. Activin is strongly expressed in wounded skin, and overexpression of activin in epidermis of transgenic mice improves wound healing and enhances scar formation. Activin also regulates the morphogenesis of branching organs such as the prostate, lung, and kidney. There is also evidence showed that lack of activin during development results in neural developmental defects.

  • Tanimoto K, et al. (1992) Structure and sequence analysis of the human activin beta A subunit gene. DNA Seq. 2 (2): 103-10.
  • Welt C, et al. (2002) Activins, inhibins, and follistatins: from endocrinology to signaling. A paradigm for the new millennium. Exp Biol Med. 227 (9): 724-52.
  • Xu J, et al. (1995) Inhibin antagonizes inhibition of liver cell growth by activin by a dominant-negative mechanism. J Biol Chem. 270 (11): 6308-13.