Quick Order

Human TROP2 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TROP2/TACSTD2 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

TROP-2, also referred to as tumor associated calcium signal transducer 2 (TACSTD2), GA733-1 or M1S1, is a cell surface glycoprotein highly expressed in a wide variety of epithelial cancers. In contrast, there is little or no expression of Trop-2 in adult somatic tissue. Because it is a cell surface protein that is selectively expressed in tumor cells, Trop-2 is a potential therapeutic target. The cytoplasmic tail of Trop-2 possesses potential serine and tyrosine phosphorylation sites and a phosphatidyl-inositol binding consensus sequence. Trop-2 transduces an intracellular calcium signal, are consistent with the hypothesis that it acts as a cell surface receptor and support a search for a physiological ligand. TROP2 encoding by an intronless gene was originally defined by the monoclonal antibody GA733, and is a member of a family of at least two type I membrane proteins. The other known member is GA733-2, also called EpCAM and TROP1. It has been suggested by studies that the GA733-1 gene was formed by the retroposition of the GA733-2 gene via an mRNA intermediate.

  • Ripani E, et al. (1998) Human Trop-2 is a tumor-associated calcium signal transducer. Int J Cancer. 76(5): 671-6.
  • Wang J, et al. (2008) Identification of Trop-2 as an oncogene and an attractive therapeutic target in colon cancers. Mol Cancer Ther. 7(2): 280-5.