Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human Vitronectin cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Vitronectin, also known as VTN, is a member of the pexin family. It is an abundant glycoprotein found in serum the extracellular matrix and promotes cell adhesion and spreading. Vitronectin is a secreted protein and exists in either a single chain form or a cleaved, two chain form held together by a disulfide bond. Vitronectin is a plasma glycoprotein implicated as a regulator of diverse physiological process, including blood coagulation, fibrinolysis, pericellular proteolysis, complement dependent immune responses, and cell attachment and spreading. Because of its ability to bind platelet glycoproteins and mediate platelet adhesion and aggregation at sites of vascular injury, vitronectin has become an important mediator in the pathogenesis of coronary atherosclerosis. As a multifunctional protein with a multiple binding domain, Vitronectin interacts with a variety of plasma and cell proteins. Vitronectin binds multiple ligands, including the soluble vitronectin receptor. It may be an independent predictor of adverse cardiovascular outcomes following acute stenting. Accordingly, Vitronectin is suggested to be involved in hemostasis, cell migration, as well as tumor malignancy.

References
  • Ekmeki OB, et al. (2006) Vitronectin in atherosclerotic disease. Clin Chim Acta. 368(1-2): 77-83.
  • Derer W, et al. (2009) Vitronectin concentrations predict risk in patients undergoing coronary stenting. Circ Cardiovasc Interv. 2(1): 14-9.
  • Heyman L, et al. (2010) Mesothelial vitronectin stimulates migration of ovarian cancer cells. Cell Biol Int. 34(5): 493-502.
  • Images
    • Human Vitronectin Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"