Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human IL6R cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human IL6R Gene Plasmid Map
Human IL6R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Human Interleukin-31 receptor A / IL31RA Protein (Fc Tag, ECD)Canine IL-6R / CD126 Protein (ECD, His Tag)Human Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA Protein (Fc Tag)Human G-CSF / CSF3 Protein (isoform b)Human IL6ST / gp130 / CD130 Protein (ECD, Fc Tag)Rat IL-11RA1 / Il11RA1 Protein (His Tag)Mouse CNTF / Ciliary Neurotrophic Factor Protein (His Tag)Human NNT1 / CLCF1 / CLC Protein (Fc Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Human IL6 / Interleukin-6 ProteinHuman IL6R / CD126 Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His & Fc Tag)Human Leptin ProteinHuman LIFR / CD118 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6RA / CD126 Protein (His Tag)Mouse IL11RA / IL11Rα Protein (His Tag)Human OSMR / IL31RB Protein (His Tag)Human CNTFR / CNTFR-alpha Protein (His Tag)Human IL11RA / IL11Rα Protein (His Tag)Mouse LIFR / CD118 Protein (His Tag)Human Leptin Receptor / LEPR / CD295 Protein (His Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Human CNTF Protein (His Tag)Mouse IL-31 / IL31 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat CNTFR / CNTFR-alpha Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Rat CNTF / Ciliary Neurotrophic Factor ProteinHuman G-CSFR / CD114 Protein (His Tag)Mouse OSMR / IL-31RB Protein (His Tag)Human Oncostatin M / OSM Protein (His Tag)Human GM-CSF / CSF2 Protein (His Tag)Rat IL-6R / CD126 Protein (ECD, His Tag)Human G-CSF / CSF3 Protein (isoform b)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse Oncostatin M / OSM Protein (His Tag)Mouse IL6 / Interleukin-6 ProteinRat IL6 / Interleukin-6 ProteinRat LIFR Protein (His Tag)Rhesus IL6 / Interleukin-6 ProteinHuman IL11 / Interleukin 11 / IL-11 ProteinHuman LIF Protein (His Tag)Human LIF Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Rhesus IL6ST / gp130 Protein (Fc Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rhesus IL6ST / gp130 Protein (His Tag)Human IL6ST / gp130 / CD130 ProteinHuman GM-CSF / CSF2 ProteinHuman GM-CSF / CSF2 ProteinCanine IL11RA / IL-11RA / IL11Rα ProteinRat GM-CSF / CSF2 Protein (Fc Tag)Mouse Oncostatin M / OSM ProteinCanine IL11RA / IL-11RA / IL11Rα Protein (His Tag)Human LIF ProteinHuman IL-31 / IL31 Protein (His Tag)Mouse GM-CSF / CSF2 ProteinMouse IL-11 / interleukin 11 ProteinSus scrofa (pig) IL6 / IL-6 ProteinRat IL-6R / CD126 Protein (Fc Tag, ECD)Mouse LIF ProteinHuman Interleukin-31 receptor A / IL31RA Protein (His Tag)

Interleukin 6 receptor (IL-6R) also known as CD126 (Cluster of Differentiation 126) is a type I cytokine receptor. The low concentration of a soluble form of IL-6 receptor (sIL-6R) acts as an agonist of IL-6 activity. In the IL-6R/CD126/IL6R system, both a membrane-bound IL-6R and a sIL-6R protein are able to mediate IL-6 signals into the cells through the interaction of gp130. The resulting IL-6/sIL-6R protein complex is also capable of binding to gp130 and inducing intracellular signalling. Through this so-called 'trans-signalling' mechanism, IL-6 is able to stimulate cells that lack an endogenous mIL-6R. High levels of IL-6 and sIL-6R have been reported in several chronic inflammatory and autoimmune diseases as well as in cancer.

  • Barill S, et al. (2000) The role of interleukin-6 and interleukin-6/interleukin-6 receptor-alpha complex in the pathogenesis of multiple myeloma. Eur Cytokine Netw. 11(4): 546-51.
  • Kang KW, et al. (2007) Novel role of IL-6/SIL-6R signaling in the expression of inducible nitric oxide synthase (iNOS) in murine B16, metastatic melanoma clone F10.9, cells. Free Radic Biol Med. 42(2): 215-27.
  • Images
    • Human IL6R transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items