After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human IL5RA cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human IL5RA Gene Plasmid Map
Human IL5Ra transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Mouse CD123 / IL3RA Protein (ECD, Fc Tag)Human IL3 / IL-3 Protein (His Tag)Cynomolgus / Rhesus IL21R / IL-21R Protein (Fc Tag)Human IL3 / IL-3 ProteinMouse IL-21R / Il21R Protein (ECD, His Tag)Rat IL9 / IL-9 Protein (His Tag)Rhesus CD122 / IL-2RB Protein (Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Rhesus CD122 / IL-2RB Protein (His Tag)Mouse IL7 / Interleukin 7 ProteinMouse CD123 / IL3RA Protein (ECD, His Tag)Cynomolgus CD127 / IL-7RA Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL13 / ALRH Protein (Fc Tag)Human IL13RA2 / CD213A2 Protein (His Tag)Human IL13RA2 / IL13R Protein (His & Fc Tag)Mouse IL2RG Protein (His & Fc Tag)Human IL2Ra / CD25 Protein (Fc Tag)Human CD122 / IL-2RB Protein (Fc Tag)Human CD122 / IL-2RB ProteinCynomolgus IL13 / ALRH ProteinMouse IL-13Ra1 Protein (His & Fc Tag)Mouse IL-34 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His & Fc Tag)Human Interleukin-32 / IL-32 Protein (isoform alpha, His Tag)Human IL4R / CD124 Protein (His Tag)Human IL13RA1 Protein (His & Fc Tag)Human IL7RA / CD127 Protein (His & Fc Tag)Human IL2Ra / CD25 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His Tag)Mouse IL13RA1 Protein (His Tag)Human IL7RA / CD127 Protein (His Tag)Human IL13RA1 Protein (His Tag)Mouse IL7RA / CD127 Protein (His Tag)Human IL3RA / CD123 Protein (His Tag)Human IL3RA / CD123 Protein (His & Fc Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Mouse IL2RG / CD132 Protein (His Tag)Human IL4 / Interleukin-4 ProteinHuman IL-9 / Interleukin-9 Protein (His Tag)Human IL5Ra / CD125 Protein (His Tag)Human IL-3 / Interleukin-3 Protein (His Tag)Mouse IL2RA / CD25 Protein (His Tag)Human IL-21R / Interleukin-21 Receptor Protein (His Tag)Human Interleukin-21 / IL-21 ProteinHuman IL13 / ALRH ProteinMouse IL-4R / CD124 Protein (ECD, His Tag)Cynomolgus IL13 / ALRH Protein (His Tag)Human IL16 / Interleukin-16 Protein (His Tag)Rat Interleukin-2 / IL-2 ProteinHuman IL2RG / CD132 Protein (His Tag)Mouse IL5 Protein (His Tag)Mouse IL4 / Interleukin-4 ProteinCanine Interleukin-2 / IL-2 Protein (147 Cys/Ser)Rat IL9R / Interleukin 9 receptor Protein (His Tag)Canine IL5 Protein (His Tag)Rat IL3 / interleukin 3 Protein (His Tag)Mouse Interleukin-2 / IL-2 ProteinCanine IL4 / Interleukin-4 ProteinMouse IL21 / Interleukin 21 ProteinCanine IL21 / Interleukin 21 ProteinRat IL4R / Il4ra Protein (His Tag)Human IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (His Tag)Rat IL13RA1 Protein (Fc Tag)Rat IL-21R / Interleukin-21 Receptor Protein (His Tag)Rat IL13RA2 / IL13R Protein (His Tag)Canine IL-8 / CXCL8 ProteinMouse IL13 / ALRH ProteinRat IL7R / IL7RA Protein (Fc Tag)Rat IL13RA2 / IL13R Protein (Fc Tag)Human IL7 / interleukin 7 ProteinRat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Rhesus IL-8 / CXCL8 ProteinMouse IL5Ra / CD125 Protein (His Tag)Rat IL4R / Il4ra Protein (Fc Tag)Rat IL21 / Interleukin 21 Protein (His Tag)Mouse IL4 / Interleukin-4 Protein (Q136D, Y139D, His Tag)Cynomolgus IL2RA Protein (His Tag)Rat IL7R / IL7RA Protein (His Tag)Cynomolgus IL2RA Protein (Fc Tag)Canine IL13RA2 / IL13R Protein (His Tag)Cynomolgus IL2RA ProteinCanine IL13RA2 / IL13R Protein (Fc Tag)Human IL5 / Interleukin 5 ProteinMouse CD122 / IL2RB / IL2 Receptor beta Protein (His Tag)Canine IL3RA Protein (His Tag)Canine IL2RB / IL2 Receptor beta Protein (Fc Tag)Rat IL7 / interleukin 7 ProteinHuman IL-15 / IL15 / Interleukin 15 Protein (His Tag)Human IL2 / Interleukin-2 Protein (L35M, L36S, C142A)Cynomolgus IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL-15 / IL15 / Interleukin 15 ProteinHuman IL-8 / CXCL8 Protein (His Tag)Mouse IL16 / Interleukin-16 Protein (His Tag)

Interleukin 5 receptor, alpha (IL5RA) also known as CD125 (Cluster of Differentiation 125) is a subunit of the Interleukin-5 receptor. IL5RA (CD125) is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Six alternatively spliced transcript variants encoding three distinct isoforms have been reported. IL5RA (CD125) is a T-cell-derived cytokine which is particularly important in the development of asthma for the lerminal differentiation, activation and survival of committed cosinophil precursors.

  • Isobe M, et al. (1992) Localization of the gene encoding the alpha subunit of human interleukin-5 receptor (IL5RA) to chromosome region 3p24-3p26. Genomics. 14(3): 755-8.
  • Cheong HS, et al. (2005) Association analysis of interleukin 5 receptor alpha subunit (IL5RA) polymorphisms and asthma. J Hum Genet. 50(12): 628-34.
  • Isobe M, et al. (1992) Localization of the gene encoding the alpha subunit of human interleukin-5 receptor (IL5RA) to chromosome region 3p24-3p26. Genomics. 14(3): 755-8.
  • Images
    • Human IL5Ra transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.