Quick Order

Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human TIM3 cDNA Clone Product Information
Gene_bank_ref_id:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Hepatitis A virus cellular receptor 2 (HAVCR2), formerly known as T cell immunoglobulin and mucin domain-3 (TIM-3), is a transmembrane glycoprotein expressed on the surface of terminally differentiated Th1 cells but not on Th2 cells. It was the first surface molecule that specifically identifies Th1 cells in both mice and human. Recently, identification of Galectin-9 as a ligand for TIM-3 has established the TIM-3-Galectin-9 pathway as an important regulator of Th1 immunity and tolerance induction. Engagement of Tim-3 by its ligand galectin-9 negatively regulates IFN-gamma secretion and influences the ability to induce T cell tolerance in both mice and man. It suggests a novel paradigm in which dysregulation of the TIM-3-galectin-9 pathway could underlie chronic autoimmune disease states, such as multiple sclerosis. Recent work has explored the role of TIM-3 in systemic lupus erythematosus (SLE), and their results indicate that TIM-3 may represent a novel target for the treatment of SLE. Numerous studies have demonstrated that Tim-3 influences autoimmune diseases, including diabetes and multiple sclerosis, and its role in other inflammatory diseases including allergies and cancer is beginning to become clear. In tumor rejection model, soluble form of Tim-3 (sTim-3) significantly impaired T cell antitumor immunity, evidenced by decreased antitumor CTL activity and reduced amount of tumor-infiltrating lymphocytes in tumor. sTim-3 as an immunoregulatory molecule that may be involved in the negative regulation of T cell-mediated immune response.

References
  • Geng H, et al. (2006) Soluble form of T cell Ig mucin 3 is an inhibitory molecule in T cell-mediated immune response. J Immunol. 176(3): 1411-20.
  • Anderson AC, et al. (2006) TIM-3 in autoimmunity. Curr Opin Immunol. 18(6): 665-9.
  • Anderson DE. (2007) TIM-3 as a therapeutic target in human inflammatory diseases. Expert Opin Ther Targets. 11(8): 1005-9.
  • Pan HF, et al. (2010) TIM-3 as a new therapeutic target in systemic lupus erythematosus. Mol Biol Rep. 37(1): 395-8.
  • Images
    • Human TIM3 / HAVCR2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"