After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human CNTN1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CNTN1cDNA Clone Product Information
cDNA Size:3057
cDNA Description:ORF Clone of Homo sapiens contactin 1, transcript variant 1 DNA.
Gene Synonym:F3, GP135, CNTN1
Restriction Site:KpnI + NotI
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Human CNTN1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged on other vectors
Related Products
Product nameProduct name

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2 (TAG-1), Contactin-3 (BIG-1), BIG-2, Contactin-5 (NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-1 is a cell surface adhesion molecule that is normally expressed by neurons and oligodendrocytes. Particularly high levels of Contactin-1 are present during brain development. Contactin-1 and Contactin-2 are differentially expressed in a number of neuronal tissues during development, and they interact with several ligands including Nr-CAM, L1, NCAM, neurocan, phosphacan, and tenascin. As a cell adhesion molecule, Contactin-1 plays a role in the formation of axon connections in the developing nervous system. It was demonstrated that Contactin-1 participates in signal pathways via its association with Contactin-associated protein (CNTNAP1), receptor protein tyrosine phosphatase beta (RPTPb) and NOTCH1. Contactin-1 is also involved in paranodal axo-glial junction formation and oligodendrocytes generation. Furthermore, studies indicated that Contactin-1 functions importantly in the invasion and metastasis of lung adenocarcinoma cells. Contactin-1 may also significantly influence the functional expression and distribution of Na+ channels in neurons.

  • Kazarinova NK, et al. (2001) Contactin associates with Na+ channels and increases their functional expression. J Neurosci. 21 (19):7517-25.
  • Eckerich C, et al. (2006) Contactin is expressed in human astrocytic gliomas and mediates repulsive effects. Glia. 53(1):1-12.
  • Su JL, et al. (2006) Knockdown of contactin-1 expression suppresses invasion and metastasis of lung adenocarcinoma. Cancer research 66 (5):2553-61.
  • Compton AG, et al. (2008) Mutations in contactin-1, a neural adhesion and neuromuscular junction protein, cause a familial form of lethal congenital myopathy. Am J Hum Genet. 83 (6):714-24.
  • Mikami T, et al. (2009) Contactin-1 is a functional receptor for neuroregulatory chondroitin sulfate-E. J Biol Chem. 284(7):4494-9.
  • Size / Price
    List Price: $545.00  (Save $150.00)
    Price:$395.00      [How to order]
    Availability5 business days
    • Human CNTN1 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items