After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human BIRC5 transcript variant 1 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human BIRC5 cDNA Clone Product Information
NCBI RefSeq:NM_001168.2
RefSeq ORF Size:429bp
cDNA Description:Full length Clone DNA of Homo sapiens baculoviral IAP repeat-containing 5, transcript variant 1.
Gene Synonym:API4, EPR-1
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-BIRC5-t1
Restriction Site:HindIII + XbaI (5.5kb + 0.43kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human BIRC5 Gene Plasmid Map
Human BIRC5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

BIRC5, also known as Survivin and EPR-1, is a member of the IAP family. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but BIRC5 has only a single BIR domain. It is expressed cell cycle-dependently and highly expressed at mitosis. As a multitasking protein, BIRC5 has dual roles in promoting cell proliferation and preventing apoptosis. Survivin is a component of a chromosome passage protein complex (CPC) which is essential for chromosome alignment and segregation during mitosis and cytokinesis. Survivin acts as an important regulator of the localization of this complex. It may counteract a default induction of apoptosis in G2/M phase.

References
  • Altieri DC. 1994, J Biol Chem. 269 (5): 3139-42.
  • Bouchard BA. et al., 2002, Thromb Haemost. 86 (4): 1133-5.
  • Yao XQ. et al., 2004, World J Gastroenterol. 10 (9): 1262-7.
  • Size / Price
    Catalog: HG10356-M-N
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"