After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human SLPI natural ORF mammalian expression plasmid, HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human SLPI cDNA Clone Product Information
Gene_bank_ref_id:NM_003064.2
RefSeq ORF Size:399bp
cDNA Description:Full length Clone DNA of Homo sapiens secretory leukocyte peptidase inhibitor with HA tag.
Gene Synonym:ALP, MPI, ALK1, BLPI, HUSI, WAP4, WFDC4, HUSI-I
Species:Human
Vector:pCMV2-HA
Plasmid:pCMV2-SLPI-ha
Restriction Site:KpnI + XhoI (5.4kb + 0.45kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-HA Vector Information
 
Vector Name pCMV2-HA
Vector Size 5595bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV2-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Secretory leukoprotease inhibitor (SLPI), also called antileukoprotease (ALP), is a 12-kDa, nonglycosylated serine protease inhibitor present in mucous secretions. It is thought to play a role in protecting the mucosae from injury associated with inflammation. SLPI is locally produced by serous cells, including bronchial submucosal glands. Elafin and SLPI are members of larger families of proteins secreted predominantly at mucosal sites, and have been shown to be modulated in multiple pathological conditions. Elafin and SLPI are structurally related in that both have a fold with a four-disulfide core or whey acidic protein (WAP) domain responsible for inhibiting proteases. SLPI is a prominent innate immune protein of the respiratory tract, possessing serine protease inhibitor activity, antibacterial activity, and anti-inflammatory/immunomodulatory activity.

References
  • Moreau T, et al. (2008) Multifaceted roles of human elafin and secretory leukocyte proteinase inhibitor (SLPI), two serine protease inhibitors of the chelonianin family. Biochimie. 90(2): 284-95.
  • Weldon S, et al. (2007) Innate host defense functions of secretory leucoprotease inhibitor. Exp Lung Res. 33(10): 485-91.
  • Williams SE, et al. (2006) SLPI and elafin: one glove, many fingers. Clin Sci (Lond). 110(1): 21-35.
  • Kikuchi T, et al. (1996) Regulation of secretory leukoprotease inhibitor gene expression. Nihon Rinsho. 54(2): 405-10.
  • Size / Price
    Catalog: HG10343-M-Y
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn Stock Shipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"