Quick Order

Text Size:AAA

Human CD50 / ICAM3 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human ICAM3 cDNA Clone Product Information
RefSeq ORF Size:1644bp
cDNA Description:Full length Clone DNA of Homo sapiens intercellular adhesion molecule 3 with Flag tag.
Gene Synonym:CD50, CDW50, ICAM-R
Restriction Site:HindIII + XbaI (5.4kb + 1.69kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ICAM3 Gene Plasmid Map
Human CD50 / ICAM3 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

The protein ICAM-3, also known as CD50, is a member of the intercellular adhesion molecule (ICAM) family consisting three members. It is a DC-SIGN ligand that is constitutively expressed on resting leukocytes, and is thus an important molecule for the first immune response. ICAM-3 comprises of five immunoglobulin-like domains, and binds LFA-1 through its two N-terminal domains. It functions not only as an adhesion molecule, but also as a potent signalling molecule. ICAM-3 binds to LFA-1 on antigen-presenting cells (APC) stabilizing the T cell-APC interaction, facilitating signaling through the CD3/TCR complex. However, recent evidence using cultured and transformed T cells suggests ICAM-3 may also function in signaling. It has been reported that CD50 molecule can play a role in developing functionally mature T lymphocytes and its expression increases during the maturation process of T lymphocytes. In addition, the interactions of ICAM-3 and LFA-1 facilitate HIV-1- induced virological synapse formation between T cells. ICAM-3 is associated with an increase of cellular radio-resistance and cancer cell proliferation. It could be considered as a candidate for anti-cancer drug development and as a cancer diagnostic marker.

  • Berney SM, et al. (1999) ICAM-3 (CD50) cross-linking augments signaling in CD3-activated peripheral human T lymphocytes. J Leukoc Biol. 65(6): 867-74.
  • van Buul JD, et al. (2004) ICAM-3 activation modulates cell-cell contacts of human bone marrow endothelial cells. J Vasc Res. 41(1): 28-37.
  • Sugino H. (2005) ICAM-3, a ligand for DC-SIGN, was duplicated from ICAM-1 in mammalian evolution, but was lost in the rodent genome. FEBS Lett. 579(13): 2901-6.
  • Park JK, et al. (2010) ICAM-3 enhances the migratory and invasive potential of human non-small cell lung cancer cells by inducing MMP-2 and MMP-9 via Akt and CREB. Int J Oncol. 36(1): 181-92.