Quick Order

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human MMP-9 cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Matrix metalloproteinases (MMPs) are neutral proteinases that are involved in the breakdown and remodeling of the extracellular matrix (ECM) under a variety of physiological and pathological conditions, such as morphogenesis, differentiation, angiogenesis and tissue remodeling, as well as pathological processes including inflammation, arthritis, cardiovascular diseases, pulmonary diseases and tumor invasion. MMP9, also known as 92-kDa gelatinase B/type IV collagenase, is secreted from neutrophils, macrophages, and a number of transformed cells, and is the most complex family member in terms of domain structure and regulation of its activity. It plays an important role in tissue remodelling in normal and pathological inflammatory processes. MMP-9 is a major secretion product of macrophages and a component of cytoplasmic granules of neutrophils, and is particularly important in the pathogenesis of inflammatory, infectious, and neoplastic diseases in many organs including the lung. This enzyme is also secreted by lymphocytes and stromal cells upon stimulation by inflammatory cytokines, or upon delivery of bi-directional activation signals following integrin-mediated cell-cell or cell-extracellular matrix (ECM) contacts. Since the integrity of the tissue architecture is closely dependent of the delicate balance between MMPs and their inhibitors, excessive production of MMP-9 is linked to tissue damage and degenerative inflammatory disorders. As a consequence, regulation of gene transcription and tissue-specific expression of MMP-9 in normal and diseased states are being actively investigated to pave the way for new therapeutic targets. In addition, the dramatic overexpression of MMP-9 in cancer and various inflammatory conditions clearly points to the molecular mechanisms controlling its expression as a potential target for eventual rational therapeutic intervention.

  • St-Pierre Y, et al. (2003) Emerging features in the regulation of MMP-9 gene expression for the development of novel molecular targets and therapeutic strategies. Curr Drug Targets Inflamm Allergy. 2(3): 206-15.
  • St-Pierre Y, et al. (2004) Regulation of MMP-9 gene expression for the development of novel molecular targets against cancer and inflammatory diseases. Expert Opin Ther Targets. 8(5): 473-89.
  • Chakrabarti S, et al. (2005) Matrix metalloproteinase-2 (MMP-2) and MMP-9 in pulmonary pathology. Exp Lung Res. 31(6): 599-621.
  • Images
    • Human MMP-9 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items